PDB ID: 1R7Z
Title: NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE Molecular Description: RNA Nucleic Acid Sequence: Chain A: G G A G G A C A U U C C U C A C G G G U G A C C G U G G U C C U C C Primary Citation: Du, Z., Ulyanov, N.B., Yu, J., Andino, R., James, T.L. NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry , 43, pp. 5757 - 5771, 2004. Experimental Information: NMR Number of Models: 20 STRUCTURES Sample Details: 1mM unlabeled RNA, 25mM NaCl, 25mM sodium phosphate buffer (pH 6.5), 90% H2O; 10% D2O 90% H2O; 10% D2O	Representative Model Other Views RNA View RNAML File Ensemble Enlarge Representative Model
Coordinates Coordinates (pdb format, Unix compressed(.gz)) Coordinates (cif format, Unix compressed(.gz)) NMR Restraints (cif format, Unix compressed(.gz)) XML | Complete with coordinates (xml format, GNU compressed(.gz)) XML | Coordinates only (xml format, GNU compressed(.gz)) XML | Header only (xml format, GNU compressed(.gz))	Derivative Data Nucleic Acid Backbone Torsions Base Pair Parameters Base Pair Step Parameters Hydrogen Bonding Classification
Links
The Protein Data Bank: 1R7Z
PubMed: 15134450
ndbadmin@ndbserver.rutgers.edu ©1995-2007 The Nucleic Acid Database Project Rutgers, The State University of New Jersey