A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 17-Sep-2014 number of released structures: 7399
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 4810   (Gallery view)

NDB ID:

2MNB

PDB ID:

2MNB 

Release:

2014-09-17

Title:

Thiazotropsin B DNA recognition sequence d(CGACGCGTCG)2

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA minor groove by thiazotropsin analogues.
Chembiochem 15 pp.1978 - 1990 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2722

PDB ID:

4M3V 

Release:

2014-09-17

Title:

X-ray crystal structure of the ruthenium complex [Ru(Tap)2(dppz-{Me2})]2+ bound to d(TCGGTACCGA)

Classification:

DNA

Authors:

Niyazi, H., Teixeira, S., Mitchell, E., Forsyth, T., Cardin, C.

Citation:

X-ray crystal structure of the ruthenium complex [Ru(Tap)2(dppz-{Me2})]2+ bound to d(TCGGTACCGA)
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.05Å R work:0.244R free:0.321

NDB ID:

2MO2

PDB ID:

2MO2 

Release:

2014-09-10

Title:

Solution NMR structure of DNA dodecamer containing the 5-hydroxycytosine

Classification:

DNA

Authors:

Szulik, M.

Citation:

Characterization of 5-hydroxycytosine in DNA
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

2MO7

PDB ID:

2MO7 

Release:

2014-09-10

Title:

Solution NMR structure of DNA dodecamer with A:C mismatch

Classification:

DNA

Authors:

Szulik, M., Donahue, P., Stone, M.

Citation:

Characterization of 5-hydroxycytosine in DNA
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

2MOE

PDB ID:

2MOE 

Release:

2014-09-10

Title:

Solution structure of MBD4 methyl-cytosine binding domain bound to methylated DNA

Classification:

Hydrolase/DNA

Authors:

Walavalkar, N.M., Cramer, J.M., Buchwald, W.A., Scarsdale, N., Williams Jr., D.C.

Citation:

Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches
Nucleic Acids Res. pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

4CH1

PDB ID:

4CH1 

Release:

2014-09-03

Title:

RRM domain from C. elegans SUP-12 bound to GGTGTGC DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Amrane, S., Rebora, K., Zniber, I., Dupuy, D., Mackereth, C.D.

Citation:

Backbone-Independent Nucleic Acid Binding by Splicing Factor Sup-12 Reveals Key Aspects of Molecular Recognition
Nat.Commun. 5 pp.4595 - 2014

Experiment:

SOLUTION NMR

NDB ID:

NA3085

PDB ID:

4QYZ 

Release:

2014-09-03

Title:

Crystal structure of a CRISPR RNA-guided surveillance complex, Cascade, bound to a ssDNA target

Classification:

IMMUNE SYSTEM/DNA/RNA

Authors:

Mulepati, S., Heroux, A., Bailey, S.

Citation:

Crystal structure of a CRISPR RNA-guided surveillance complex bound to a ssDNA target.
Science pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.0303Å R work:0.223R free:0.267

NDB ID:

NA2658

PDB ID:

4MF8 

Release:

2014-08-27

Title:

Structure of human DNA polymerase beta complexed with nicked DNA containing a mismatched template O6MG and incoming CTP

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.C., Min, K., Monzingo, A.F., Lee, S.

Citation:

Structures of human DNA polymerase beta inserting bases opposite templating O6MG
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.32Å R work:0.209R free:0.271

NDB ID:

NA2659

PDB ID:

4MFA 

Release:

2014-08-27

Title:

Structure of human DNA polymerase beta complexed with nicked DNA containing a mismatched template O6MG and incoming TTP

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.C., Min, K., Monzingo, A.F., Lee, S.

Citation:

Structures of human DNA polymerase beta inserting bases opposite templating O6MG
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.27Å R work:0.211R free:0.283

NDB ID:

NA2968

PDB ID:

4Q0R 

Release:

2014-08-27

Title:

The catalytic core of Rad2 (complex I)

Classification:

Hydrolase/DNA

Authors:

Mietus, M., Nowak, E., Jaciuk, M., Kustosz, P., Studnicka, J., Nowotny, M.

Citation:

Crystal structure of the catalytic core of Rad2: insights into the mechanism of substrate binding.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.75Å R work:0.245R free:0.31

NDB ID:

NA2969

PDB ID:

4Q0W 

Release:

2014-08-27

Title:

he catalytic core of Rad2 in complex with DNA substrate (complex II)

Classification:

Hydrolase/DNA

Authors:

Mietus, M., Nowak, E., Jaciuk, M., Kustosz, P., Studnicka, J., Nowotny, M.

Citation:

Crystal structure of the catalytic core of Rad2: insights into the mechanism of substrate binding.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.183R free:0.229

NDB ID:

NA2970

PDB ID:

4Q10 

Release:

2014-08-27

Title:

The catalytic core of Rad2 in complex with DNA substrate (complex IV)

Classification:

Hydrolase/DNA

Authors:

Mietus, M., Nowak, E., Jaciuk, M., Kustosz, P., Studnicka, J., Nowotny, M.

Citation:

Crystal structure of the catalytic core of Rad2: insights into the mechanism of substrate binding.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.231R free:0.284

NDB ID:

NA2971

PDB ID:

4Q0Z 

Release:

2014-08-27

Title:

The catalytic core of Rad2 in complex with DNA substrate (complex III)

Classification:

Hydrolase/DNA

Authors:

Mietus, M., Nowak, E., Jaciuk, M., Kustosz, P., Studnicka, J., Nowotny, M.

Citation:

Crystal structure of the catalytic core of Rad2: insights into the mechanism of substrate binding.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.398Å R work:0.178R free:0.235

NDB ID:

NA3059

PDB ID:

4QQW 

Release:

2014-08-27

Title:

Crystal structure of T. fusca Cas3

Classification:

Hydrolase/DNA

Authors:

Huo, Y., Nam, K.H., Ding, F., Lee, H., Wu, L., Xiao, Y., Farchione, M.D., Zhou, S., Rajashankar, K., Kurinov, I., Zhang, R., Ke, A.

Citation:

Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation.
Nat.Struct.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.664Å R work:0.173R free:0.226

NDB ID:

NA3061

PDB ID:

4QQY 

Release:

2014-08-27

Title:

Crystal structure of T. fusca Cas3-ADP

Classification:

Hydrolase/DNA

Authors:

Huo, Y., Nam, K.H., Ding, F., Lee, H., Wu, L., Xiao, Y., Farchione, M.D., Zhou, S., Rajashankar, K., Kurinov, I., Zhang, R., Ke, A.

Citation:

Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation.
Nat.Struct.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.12Å R work:0.17R free:0.235

NDB ID:

NA3062

PDB ID:

4QQZ 

Release:

2014-08-27

Title:

Crystal structure of T. fusca Cas3-AMPPNP

Classification:

Hydrolase/DNA

Authors:

Huo, Y., Nam, K.H., Ding, F., Lee, H., Wu, L., Xiao, Y., Farchione, M.D., Zhou, S., Rajashankar, K., Kurinov, I., Zhang, R., Ke, A.

Citation:

Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation.
Nat.Struct.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.93Å R work:0.181R free:0.233

NDB ID:

NA3074

PDB ID:

4QWE 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES of A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)FTC-DP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.215R free:0.25

NDB ID:

NA3075

PDB ID:

4QWD 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES of A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)3TC-PPNP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.05Å R work:0.224R free:0.261

NDB ID:

NA3076

PDB ID:

4QWC 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES of A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND L-DCDP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.227R free:0.277

NDB ID:

NA3077

PDB ID:

4QWB 

Release:

2014-08-27

Title:

CRYSTAL STRUCTURE of DPO4 LINKER REGION P236A MUTANT WITH AN INCOMING D-dCDP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.8Å R work:0.224R free:0.27

NDB ID:

NA3078

PDB ID:

4QWA 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES OF A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS in COMPLEX WITH DNA AND (-)3TC-DP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.219R free:0.24

NDB ID:

NA3079

PDB ID:

4QW9 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES of A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND (-)FTC-PPNP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.241R free:0.27

NDB ID:

NA3081

PDB ID:

4QW8 

Release:

2014-08-27

Title:

TERNARY CRYSTAL STRUCTURES of A Y-FAMILY DNA POLYMERASE DPO4 FROM SULFOLOBUS SOLFATARICUS IN COMPLEX WITH DNA AND D-DCTP

Classification:

TRANSFERASE/DNA

Authors:

Gaur, V., Vyas, R., Fowler, J.D., Efthimiopoulos, G., Feng, J.Y., Suo, Z.

Citation:

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase.
Nucleic Acids Res. 42 pp.9984 - 9995 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.29Å R work:0.215R free:0.234

NDB ID:

NA3001

PDB ID:

3WTV 

Release:

2014-08-20

Title:

Crystal structure of the complex comprised of ETS1(V170G), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.241R free:0.284

NDB ID:

NA3002

PDB ID:

3WTW 

Release:

2014-08-20

Title:

Crystal structure of the complex comprised of ETS1(K167A), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.9Å R work:0.218R free:0.263

NDB ID:

NA3005

PDB ID:

3WU1 

Release:

2014-08-20

Title:

Crystal structure of the ETS1-RUNX1-DNA ternary complex

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.212R free:0.248

NDB ID:

NA3060

PDB ID:

4QQX 

Release:

2014-08-20

Title:

Crystal structure of T. fusca Cas3-ATP

Classification:

Hydrolase/dna

Authors:

Huo, Y., Nam, K.-H., Ding, F., Lee, H., Wu, L., Xiao, Y., Farchione, F.D., Zhou, S., Rajashankar, R., Kurinov, I., Zhang, R., Ke, A.

Citation:

Structures of CRISPR Cas3 offer mechanistic insights into Cascade-activated DNA unwinding and degradation
Nat.Struct.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.34Å R work:0.171R free:0.226

NDB ID:

NA2630

PDB ID:

3WGI 

Release:

2014-08-13

Title:

Crystal structure of RSP in complex with beta-NAD+ and operator DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zheng, Y., Ko, T.-P., Guo, R.-T.

Citation:

Redox level sensing by RSP binding to NAD and DNA
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.25Å R work:0.193R free:0.228

NDB ID:

NA2936

PDB ID:

4OU6 

Release:

2014-08-13

Title:

Crystal structure of DnaT84-153-dT10 ssDNA complex form 1

Classification:

REPLICATION/DNA

Authors:

Liu, Z., Chen, P., Wang, X., Cai, G., Niu, L., Teng, M., Li, X.

Citation:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.96Å R work:0.188R free:0.228

NDB ID:

NA2937

PDB ID:

4OU7 

Release:

2014-08-13

Title:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode

Classification:

REPLICATION/DNA

Authors:

Liu, Z., Chen, P., Wang, X., Cai, G., Niu, L., Teng, M., Li, X.

Citation:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.83Å R work:0.183R free:0.238

NDB ID:

NA2998

PDB ID:

3WTS 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1, RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.248R free:0.279

NDB ID:

NA2999

PDB ID:

3WTT 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of phosphorylated ETS1, RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.24R free:0.277

NDB ID:

NA3000

PDB ID:

3WTU 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1 (V170A), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.231R free:0.282

NDB ID:

NA3003

PDB ID:

3WTX 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1(Y329A), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.237R free:0.27

NDB ID:

NA3004

PDB ID:

3WTY 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1(G333P), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.226R free:0.268

NDB ID:

NA3071

PDB ID:

4QTJ 

Release:

2014-08-13

Title:

Complex of WOPR domain of Wor1 in Candida albicans with the 13bp dsDNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zhang, S., Zhang, T., Yan, M., Ding, J., Chen, J.

Citation:

Crystal structure of the WOPR-DNA complex and implications for Wor1 function in white-opaque switching of Candida albicans.
Cell Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.205R free:0.248

NDB ID:

NA3072

PDB ID:

4QTK 

Release:

2014-08-13

Title:

Complex of WOPR domain of Wor1 in Candida albicans with the 17bp dsDNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zhang, S., Zhang, T., Yan, M., Ding, J., Chen, J.

Citation:

Crystal structure of the WOPR-DNA complex and implications for Wor1 function in white-opaque switching of Candida albicans.
Cell Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.99Å R work:0.22R free:0.271

NDB ID:

NA3109

PDB ID:

4UUV 

Release:

2014-08-13

Title:

Structure of the DNA binding ETS domain of human ETV4 in complex with DNA

Classification:

TRANSCRIPTION

Authors:

Newman, J.A., Aitkenhead, H., Cooper, C.D.O., Shrestha, L., Burgess-Brown, N., Kopec, J., Von Delft, F., Arrowsmith, C.H., Bountra, C., Edwards, A.M., Gileadi, O.

Citation:

Structure of the Ets Domain of Human Etv4 in Complex with DNA
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.202R free:0.247

NDB ID:

NA2955

PDB ID:

4PU3 

Release:

2014-08-06

Title:

Shewanella oneidensis MR-1 Toxin Antitoxin System HipA, HipB and its operator DNA complex (space group P212121)

Classification:

TOXIN/ANTITOXIN/DNA

Authors:

Wen, Y., Behiels, E., Felix, J., Elegheert, J., Vergauwen, B., Devreese, B., Savvides, S.N.

Citation:

The bacterial antitoxin HipB establishes a ternary complex with operator DNA and phosphorylated toxin HipA to regulate bacterial persistence.
Nucleic Acids Res. 42 pp.10134 - 10147 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.39Å R work:0.256R free:0.315

NDB ID:

NA2956

PDB ID:

4PU4 

Release:

2014-08-06

Title:

Shewanella oneidensis MR-1 Toxin Antitoxin System HipA, HipB and its operator DNA complex (space group P21)

Classification:

TOXIN/ANTITOXIN/DNA

Authors:

Wen, Y., Behiels, E., Felix, J., Elegheert, J., Vergauwen, B., Devreese, B., Savvides, S.N.

Citation:

The bacterial antitoxin HipB establishes a ternary complex with operator DNA and phosphorylated toxin HipA to regulate bacterial persistence.
Nucleic Acids Res. 42 pp.10134 - 10147 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.786Å R work:0.236R free:0.306

NDB ID:

2MND

PDB ID:

2MND 

Release:

2014-07-30

Title:

Recognition complex of DNA d(CGACGCGTCG)2 with thiazotropsin B

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA minor groove by thiazotropsin analogues.
Chembiochem 15 pp.1978 - 1990 2014

Experiment:

SOLUTION NMR

NDB ID:

2MNE

PDB ID:

2MNE 

Release:

2014-07-30

Title:

Recognition complex of DNA d(CGACTAGTCG)2 with thiazotropsin analogue AIK-18/51

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA minor groove by thiazotropsin analogues.
Chembiochem 15 pp.1978 - 1990 2014

Experiment:

SOLUTION NMR

NDB ID:

2MNF

PDB ID:

2MNF 

Release:

2014-07-30

Title:

AIK-18/51 DNA recognition sequence d(CGACTAGTCG)2

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA minor groove by thiazotropsin analogues.
Chembiochem 15 pp.1978 - 1990 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2974

PDB ID:

4PY5 

Release:

2014-07-30

Title:

Ribonuclease-nucleic acid complex

Classification:

Hydrolase/DNA/RNA

Authors:

Figiel, M., Nowotny, M.

Citation:

Crystal structure of RNase H3-substrate complex reveals parallel evolution of RNA/DNA hybrid recognition.
Nucleic Acids Res. 42 pp.9285 - 9294 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.183R free:0.232

NDB ID:

NA2980

PDB ID:

4Q4Z 

Release:

2014-07-30

Title:

RPase complex 1

Classification:

transcription/DNA

Authors:

Basu, R.S., Warner, B.A., Molodtsov, V., Pupov, D., Esyunina, D., Fernandez-Tornero, C., Kulbachinskiy, A., Murakami, K.S.

Citation:

Structural Basis of Transcription Initiation by Bacterial RNA Polymerase holoenzyme.
J.Biol.Chem. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.9Å R work:0.255R free:0.274

NDB ID:

NA3024

PDB ID:

4QEO 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHH DNA, H3(1-15) peptide and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell 55 pp.495 - 504 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.186R free:0.225

NDB ID:

NA3025

PDB ID:

4QEN 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHH DNA and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell 55 pp.495 - 504 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.002Å R work:0.175R free:0.211

NDB ID:

NA3026

PDB ID:

4QEP 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHG DNA and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell 55 pp.495 - 504 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.1Å R work:0.21R free:0.25

NDB ID:

NA3082

PDB ID:

4D1Q 

Release:

2014-07-30

Title:

Hermes transposase bound to its terminal inverted repeat

Classification:

PROTEIN-DNA COMPLEX

Authors:

Hickman, A.B., Ewis, H.E., Li, X., Knapp, J.A., Laver, T., Doss, A., Tolun, G., Steven, A.C., Grishaev, A., Bax, A., Atkinson, P.W., Craig, N.L., Dyda, F.

Citation:

Structural Basis of Hat Transposon End Recognition by Hermes, an Octameric DNA Transposase from Musca Domestica.
Cell(Cambridge,Mass.) 158 pp.353 - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.4Å R work:0.211R free:0.254

NDB ID:

2M6W

PDB ID:

2M6W 

Release:

2014-07-23

Title:

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Classification:

DNA

Authors:

Karsisiotis, A., Webba da Silva, M.

Citation:

Programming the Self-Assembly of a DNA G-Quadruplex Architecture
To be Published pp. - 0

Experiment:

SOLUTION NMR