A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 23-Jul-2014 number of released structures: 7272
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 4760   (Gallery view)

NDB ID:

2M6W

PDB ID:

2M6W 

Release:

2014-07-23

Title:

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Classification:

DNA

Authors:

Karsisiotis, A., Webba da Silva, M.

Citation:

Programming the Self-Assembly of a DNA G-Quadruplex Architecture
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

NA3068

PDB ID:

4UN3 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.593Å R work:0.217R free:0.252

NDB ID:

NA3069

PDB ID:

4UN4 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target with mismatches at positions 1-2

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.371Å R work:0.216R free:0.248

NDB ID:

NA3070

PDB ID:

4UN5 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target containing mismatches at positions 1-3

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.214R free:0.246

NDB ID:

2M6V

PDB ID:

2M6V 

Release:

2014-07-16

Title:

Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions

Classification:

DNA

Authors:

Karsisiotis, A., Webba da Silva, M.

Citation:

Programming the Self-Assembly of a DNA G-Quadruplex Architecture
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

NA2433

PDB ID:

4K4G 

Release:

2014-07-16

Title:

Ternary crystal structures of human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND L-DCTP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W., Suo, Z.

Citation:

Structural and Kinetic insights into binding and incorporation of Nucleotide analogs with L-stereochemistry catalysed by human DNA Polymerase Lambda
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.2R free:0.249

NDB ID:

NA2434

PDB ID:

4K4H 

Release:

2014-07-16

Title:

Ternary crystal structures of a human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND (-)3TC-TP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W., Suo, Z.

Citation:

Structural and Kinetic insights into binding and incorporation of Nucleotide analogs with L-stereochemistry catalysed by human DNA Polymerase Lambda
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.204R free:0.259

NDB ID:

NA2435

PDB ID:

4K4I 

Release:

2014-07-16

Title:

Ternary crystal structures of a human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND (-)FTC-TP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W., Suo, Z.

Citation:

Structural and Kinetic insights into binding and incorporation of Nucleotide analogs with L-stereochemistry catalysed by human DNA Polymerase Lambda
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.25Å R work:0.212R free:0.274

NDB ID:

NA2614

PDB ID:

4LQ0 

Release:

2014-07-16

Title:

Crystal structure of the I-LtrWI LAGLIDADG homing endonuclease bound to target DNA.

Classification:

HYDROLASE/DNA

Authors:

Chik, J., Shen, B., Stoddard, B.

Citation:

Structural Comparisons of LAGLIDADG Homing Endonucleases.
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.68Å R work:0.196R free:0.271

NDB ID:

NA2766

PDB ID:

4NHJ 

Release:

2014-07-16

Title:

Crystal structure of Klebsiella pneumoniae RstA DNA-binding domain in complex with RstA box

Classification:

TRANSCRIPTION REGULATOR/DNA

Authors:

Li, Y.C., Chang, C.K., Chang, C.F., Cheng, Y.H., Fang, P.J., Yu, T., Chen, S.C., Li, Y.C., Hsiao, C.D., Huang, T.H.

Citation:

Structural dynamics of the two-component response regulator RstA in recognition of promoter DNA element.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.701Å R work:0.216R free:0.271

NDB ID:

NA2982

PDB ID:

4Q5S 

Release:

2014-07-09

Title:

RPase in complex with DNA and RNA

Classification:

transcription/DNA/rna

Authors:

Basu, R.S., Warner, B.A., Molodtsov, V., Pupov, D., Esyunina, D., Fernandez-Tornero, C., Kulbachinskiy, A., Murakami, K.

Citation:

Structural basis of transcription initiation by bacterial RNA polymerase holoenzyme
J.Biol.Chem. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.269R free:0.293

NDB ID:

NA3050

PDB ID:

4CJA 

Release:

2014-07-09

Title:

BurrH DNA-binding protein from Burkholderia rhizoxinica in complex with its target DNA

Classification:

TRANSCRIPTION

Authors:

Stella, S., Molina, R., Lopez-Mendez, B., Juillerat, A., Bertonati, C., Daboussi, F., Campos-Olivas, R., Duchateau, P., Montoya, G.

Citation:

Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D 70 pp.2042 - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.651Å R work:0.202R free:0.267

NDB ID:

2MH6

PDB ID:

2MH6 

Release:

2014-07-02

Title:

Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link

Classification:

DNA

Authors:

O'Flaherty, D.K., Denisov, A.Y., Noronha, A.M., Wilds, C.J.

Citation:

NMR Structure of an Ethylene Interstrand Cross-Linked DNA which Mimics the Lesion Formed by 1,3-Bis(2-chloroethyl)-1-nitrosourea.
Chemmedchem pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2546

PDB ID:

4L5K 

Release:

2014-07-02

Title:

Crystal structure of the complex of DNA hexamer d(CGATCG) with Coptisine

Classification:

DNA

Authors:

Ferraroni, M., Bazzicalupi, C., Gratteri, P.

Citation:

Crystal structure of the complex of DNA hexamer d(CGATCG) with Coptisine
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.71Å R work:0.267

NDB ID:

NA2591

PDB ID:

4LG0 

Release:

2014-07-02

Title:

Structure of a ternary FOXO1-ETS1 DNA complex

Classification:

TRANSCRIPTION/DNA

Authors:

Birrane, G., Choy, W.C., Datta, D., Geiger, C.A., Grant, M.A.

Citation:

Structure of a ternary FOXO1-ETS1 DNA complex
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.19Å R work:0.194R free:0.243

NDB ID:

NA2818

PDB ID:

4O5C 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7-MG as the template base in a 1-nucleotide gapped DNA

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.363Å R work:0.2R free:0.245

NDB ID:

NA2819

PDB ID:

4O5E 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7MG in the template base paired with incoming non-hydrolyzable TTP

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.532Å R work:0.205R free:0.272

NDB ID:

NA2820

PDB ID:

4O5K 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7MG in the template base paired with incoming non-hydrolyzable CTP

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.058Å R work:0.2R free:0.251

NDB ID:

NA2869

PDB ID:

4O5W 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.6Å R work:0.224R free:0.255

NDB ID:

NA2870

PDB ID:

4O5X 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine.

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.6Å R work:0.247R free:0.268

NDB ID:

NA2871

PDB ID:

4O5Y 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.75Å R work:0.228R free:0.268

NDB ID:

NA2872

PDB ID:

4O5Z 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.75Å R work:0.227R free:0.263

NDB ID:

NA2912

PDB ID:

4OPX 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2R)-5-fluoro-2-methyl-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.314Å R work:0.302R free:0.324

NDB ID:

NA2913

PDB ID:

4OQA 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2Z)-2-(2,4-dihydroxybenzylidene)-3-oxo-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.65Å R work:0.298R free:0.334

NDB ID:

NA2914

PDB ID:

4OQB 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2Z)-2-{4-[2-(morpholin-4-yl)ethoxy]benzylidene}-3-oxo-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.362Å R work:0.321R free:0.349

NDB ID:

NA2966

PDB ID:

4PXI 

Release:

2014-07-02

Title:

Elucidation of the Structural and Functional Mechanism of Action of the TetR Family Protein, CprB from S. coelicolor A3(2)

Classification:

TRANSCRIPTION/DNA

Authors:

Hussain, B., Ruchika, B., Aruna, B., Ruchi, A.

Citation:

Structural and functional basis of transcriptional regulation by TetR family protein CprB from S. coelicolor A3(2)
Nucleic Acids Res. pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.219R free:0.294

NDB ID:

NA2988

PDB ID:

4Q8E 

Release:

2014-07-02

Title:

Human DNA polymerase eta inserting dCMPNPP opposite a phenanthriplatin adducted G

Classification:

TRANSFERASE/DNA

Authors:

Gregory, M.T., Park, G.Y., Johnstone, T.C., Lee, Y.S., Yang, W., Lippard, S.J.

Citation:

Structural and mechanistic studies of polymerase eta bypass of phenanthriplatin DNA damage.
Proc.Natl.Acad.Sci.USA pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.549Å R work:0.183R free:0.225

NDB ID:

NA2989

PDB ID:

4Q8F 

Release:

2014-07-02

Title:

Human DNA polymerase eta extending primer immediately after a phenanthriplatin adducted G

Classification:

TRANSFERASE/DNA

Authors:

Gregory, M.T., Park, G.Y., Johnstone, T.C., Lee, Y.S., Yang, W., Lippard, S.J.

Citation:

Structural and mechanistic studies of polymerase eta bypass of phenanthriplatin DNA damage.
Proc.Natl.Acad.Sci.USA pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.797Å R work:0.195R free:0.243

NDB ID:

NA2687

PDB ID:

4M8B 

Release:

2014-06-25

Title:

Fungal Protein

Classification:

TRANSCRIPTION/DNA

Authors:

Lohse, M.B., Rosenberg, O.S., Cox, J.S., Stroud, R.M., Finer-Moore, J.S., Johnson, A.D.

Citation:

Structure of a new DNA-binding domain which regulates pathogenesis in a wide variety of fungi.
Proc.Natl.Acad.Sci.USA pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.61Å R work:0.197R free:0.235

NDB ID:

NA2944

PDB ID:

4PQU 

Release:

2014-06-18

Title:

Crystal structure of HIV-1 Reverse Transcriptase in complex with RNA/DNA and dATP

Classification:

TRANSFERASE, HYDROLASE/DNA/RNA

Authors:

Das, K., Martinez, S.E., Bandwar, R.P., Arnold, E.

Citation:

Structures of HIV-1 RT-RNA/DNA ternary complexes with dATP and nevirapine reveal conformational flexibility of RNA/DNA: insights into requirements for RNase H cleavage.
Nucleic Acids Res. 42 pp.8125 - 8137 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.508Å R work:0.201R free:0.265

NDB ID:

NA2959

PDB ID:

4PUO 

Release:

2014-06-18

Title:

Crystal structure of HIV-1 reverse transcriptase in complex with RNA/DNA and Nevirapine

Classification:

TRANSFERASE, HYDROLASE/DNA/RNA/INHIBITOR

Authors:

Das, K., Martinez, S.E., Bandwar, R.P., Arnold, E.

Citation:

Structures of HIV-1 RT-RNA/DNA ternary complexes with dATP and nevirapine reveal conformational flexibility of RNA/DNA: insights into requirements for RNase H cleavage.
Nucleic Acids Res. 42 pp.8125 - 8137 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.901Å R work:0.228R free:0.285

NDB ID:

NA2963

PDB ID:

4PWD 

Release:

2014-06-18

Title:

Crystal structure of HIV-1 reverse transcriptase in complex with bulge-RNA/DNA and Nevirapine

Classification:

TRANSFERASE, HYDROLASE/DNA/RNA/INHIBITOR

Authors:

Das, K., Martinez, S.E., Bandwar, R.P., Arnold, E.

Citation:

Structures of HIV-1 RT-RNA/DNA ternary complexes with dATP and nevirapine reveal conformational flexibility of RNA/DNA: insights into requirements for RNase H cleavage.
Nucleic Acids Res. 42 pp.8125 - 8137 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.221R free:0.29

NDB ID:

NA2975

PDB ID:

4Q0B 

Release:

2014-06-18

Title:

Crystal structure of HIV-1 reverse transcriptase in complex with gap-RNA/DNA and Nevirapine

Classification:

TRANSFERASE, HYDROLASE/RNA/DNA/INHIBITOR

Authors:

Das, K., Martinez, S.E., Bandwar, R.P., Arnold, E.

Citation:

Structures of HIV-1 RT-RNA/DNA ternary complexes with dATP and nevirapine reveal conformational flexibility of RNA/DNA: insights into requirements for RNase H cleavage.
Nucleic Acids Res. 42 pp.8125 - 8137 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.3Å R work:0.234R free:0.317

NDB ID:

2M1V

PDB ID:

2M1V 

Release:

2014-06-11

Title:

NMR solution structure of the d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid

Classification:

DNA/RNA

Authors:

Skilandat, M., Sigel, R.K.

Citation:

The Role of Magnesium(II) for DNA Cleavage Site Recognition in Group II Intron Ribozymes -- Solution Structure and Metal Ion Binding Sites of the RNADNA Complex.
J.Biol.Chem. pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2876

PDB ID:

4OCD 

Release:

2014-06-11

Title:

In and Out the minor groove: Interaction of an AT rich-DNA with the CD27 drug

Classification:

DNA

Authors:

Acosta-Reyes, F.J., Dardonville, C., de Koning, H.P., Natto, M., Subirana, J.A., Campos, J.L.

Citation:

In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27
Acta Crystallogr.,Sect.D D70 pp.1614 - 1621 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.236R free:0.251

NDB ID:

NA3027

PDB ID:

4UNO 

Release:

2014-06-11

Title:

Crystal structure of the ETS domain of human ETV5 in complex with DNA

Classification:

DNA BINDING PROTEIN

Authors:

Newman, J.A., Aitkenhead, H., Cooper, C.D.O., Pinkas, D.M., Shrestha, L., Burgess-Brown, N., Kopec, J., Fitzpatrick, F., Tallant, C., Von Delft, F., Arrowsmith, C.H., Bountra, C., Edwards, A., Gileadi, O.

Citation:

Rystal Structure of the Ets Domain of Human Etv5 in Complex with DNA
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.95Å R work:0.172R free:0.203

NDB ID:

NA2545

PDB ID:

4KYW 

Release:

2014-06-04

Title:

Restriction endonuclease DPNI in complex with two DNA molecules

Classification:

HYDROLASE/DNA

Authors:

Mierzejewska, K., Siwek, W., Czapinska, H., Kaus-Drobek, M., Radlinska, M., Skowronek, K., Bujnicki, J.M., Dadlez, M., Bochtler, M.

Citation:

Structural basis of the methylation specificity of R.DpnI.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.201R free:0.219

NDB ID:

NA2967

PDB ID:

4PZI 

Release:

2014-06-04

Title:

Zinc finger region of MLL2 in complex with CpG DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Chao, X., Tempel, W., Liu, K., Dong, A., Bountra, C., Weigelt, J., Arrowsmith, C.H., Edwards, A.M., Min, J., Structural Genomics Consortium (SGC)

Citation:

Zinc finger region of MLL2 in complex with CpG DNA
TO BE PUBLISHED pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.225R free:0.272

NDB ID:

NA3022

PDB ID:

4CIS 

Release:

2014-06-04

Title:

Structure of MutM in complex with carbocyclic 8-oxo-G containing DNA

Classification:

HYDROLASE

Authors:

Sadeghian, K., Flaig, D., Blank, I.D., Schneider, S., Strasser, R., Stathis, D., Winnacker, M., Carell, T., Ochsenfeld, C.

Citation:

Ribose-Activated DNA Base-Excision Repair
Angew.Chem.Int.Ed.Engl. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.05Å R work:0.213R free:0.238

NDB ID:

2MB4

PDB ID:

2MB4 

Release:

2014-05-28

Title:

Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite

Classification:

DNA

Authors:

Adrian, M., Ang, D.J., Lech, C.J., Heddi, B., Nicolas, A., Phan, A.T.

Citation:

Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite.
J.Am.Chem.Soc. 136 pp.6297 - 6305 2014

Experiment:

SOLUTION NMR

NDB ID:

2MHX

PDB ID:

2MHX 

Release:

2014-05-28

Title:

Structure of Exocyclic R,R N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA

Classification:

DNA

Authors:

Kowal, E.A., Seneviratne, U., Wickramaratne, S., Doherty, K.E., Cao, X., Tretyakova, N., Stone, M.P.

Citation:

Structures of Exocyclic R,R- and S,S-N(6),N(6)-(2,3-Dihydroxybutan-1,4-diyl)-2'-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane.
Chem.Res.Toxicol. 27 pp.805 - 817 2014

Experiment:

SOLUTION NMR

NDB ID:

2MHZ

PDB ID:

2MHZ 

Release:

2014-05-28

Title:

Structure of Exocyclic S,S N6,N6-(2,3-Dihydroxy-1,4-butadiyl)-2'-Deoxyadenosine Adduct Induced by 1,2,3,4-Diepoxybutane in DNA

Classification:

DNA

Authors:

Kowal, E.A., Seneviratne, U., Wickramaratne, S., Doherty, K.E., Cao, X., Tretyakova, N., Stone, M.P.

Citation:

Structures of Exocyclic R,R- and S,S-N(6),N(6)-(2,3-Dihydroxybutan-1,4-diyl)-2'-Deoxyadenosine Adducts Induced by 1,2,3,4-Diepoxybutane.
Chem.Res.Toxicol. 27 pp.805 - 817 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2919

PDB ID:

4OSL 

Release:

2014-05-28

Title:

Crystal structure of TAL effector reveals the recognition between histidine and guanine

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.447Å R work:0.224R free:0.242

NDB ID:

NA2920

PDB ID:

4OSM 

Release:

2014-05-28

Title:

Crystal structure of the S505H mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.454Å R work:0.215R free:0.257

NDB ID:

NA2921

PDB ID:

4OSQ 

Release:

2014-05-28

Title:

Crystal structure of the S505R mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.256Å R work:0.207R free:0.25

NDB ID:

NA2922

PDB ID:

4OSR 

Release:

2014-05-28

Title:

Crystal structure of the S505K mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.944Å R work:0.2R free:0.234

NDB ID:

NA2923

PDB ID:

4OSS 

Release:

2014-05-28

Title:

Crystal structure of the S505Q mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.397Å R work:0.218R free:0.254

NDB ID:

NA2924

PDB ID:

4OST 

Release:

2014-05-28

Title:

Crystal structure of the S505C mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.996Å R work:0.201R free:0.232

NDB ID:

NA2925

PDB ID:

4OSV 

Release:

2014-05-28

Title:

Crystal structure of the S505M mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.996Å R work:0.196R free:0.235

NDB ID:

NA2926

PDB ID:

4OSW 

Release:

2014-05-28

Title:

Crystal structure of the S505E mutant of TAL effector dHax3

Classification:

DNA binding protein/DNA

Authors:

Deng, D., Yan, C.Y., Wu, J.P., Pan, X.J., Yan, N.

Citation:

Revisiting the TALE repeat
Protein Cell 5 pp.297 - 306 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.302Å R work:0.197R free:0.243