A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 13-Aug-2014 number of released structures: 7339
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 4782   (Gallery view)

NDB ID:

NA2630

PDB ID:

3WGI 

Release:

2014-08-13

Title:

Crystal structure of RSP in complex with beta-NAD+ and operator DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zheng, Y., Ko, T.-P., Guo, R.-T.

Citation:

Redox level sensing by RSP binding to NAD and DNA
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.25Å R work:0.193R free:0.228

NDB ID:

NA2936

PDB ID:

4OU6 

Release:

2014-08-13

Title:

Crystal structure of DnaT84-153-dT10 ssDNA complex form 1

Classification:

REPLICATION/DNA

Authors:

Liu, Z., Chen, P., Wang, X., Cai, G., Niu, L., Teng, M., Li, X.

Citation:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.96Å R work:0.188R free:0.228

NDB ID:

NA2937

PDB ID:

4OU7 

Release:

2014-08-13

Title:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode

Classification:

REPLICATION/DNA

Authors:

Liu, Z., Chen, P., Wang, X., Cai, G., Niu, L., Teng, M., Li, X.

Citation:

Crystal structure of DnaT84-153-dT10 ssDNA complex reveals a novel single-stranded DNA binding mode.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.83Å R work:0.183R free:0.238

NDB ID:

NA2998

PDB ID:

3WTS 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1, RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.248R free:0.279

NDB ID:

NA2999

PDB ID:

3WTT 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of phosphorylated ETS1, RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.24R free:0.277

NDB ID:

NA3000

PDB ID:

3WTU 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1 (V170A), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.231R free:0.282

NDB ID:

NA3003

PDB ID:

3WTX 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1(Y329A), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.237R free:0.27

NDB ID:

NA3004

PDB ID:

3WTY 

Release:

2014-08-13

Title:

Crystal structure of the complex comprised of ETS1(G333P), RUNX1, CBFBETA, and the tcralpha gene enhancer DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shiina, M., Hamada, K., Inoue-Bungo, T., Shimamura, M., Uchiyama, A., Baba, S., Sato, K., Yamamoto, M., Ogata, K.

Citation:

A novel allosteric mechanism on protein-DNA interactions underlying the phosphorylation-dependent regulation of Ets1 target gene expressions
J.Mol.Biol. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.226R free:0.268

NDB ID:

NA3071

PDB ID:

4QTJ 

Release:

2014-08-13

Title:

Complex of WOPR domain of Wor1 in Candida albicans with the 13bp dsDNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zhang, S., Zhang, T., Ding, J.

Citation:

Crystal structure of the WOPR-DNA complex and implications for Wor1 function in white-opaque switching of Candida albicans
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.205R free:0.248

NDB ID:

NA3072

PDB ID:

4QTK 

Release:

2014-08-13

Title:

Complex of WOPR domain of Wor1 in Candida albicans with the 17bp dsDNA

Classification:

TRANSCRIPTION/DNA

Authors:

Zhang, S., Zhang, T., Ding, J.

Citation:

Crystal structure of the WOPR-DNA complex and implications for Wor1 function in white-opaque switching of Candida albicans
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.99Å R work:0.22R free:0.271

NDB ID:

NA3109

PDB ID:

4UUV 

Release:

2014-08-13

Title:

Structure of the DNA binding ETS domain of human ETV4 in complex with DNA

Classification:

TRANSCRIPTION

Authors:

Newman, J.A., Aitkenhead, H., Cooper, C.D.O., Shrestha, L., Burgess-Brown, N., Kopec, J., Von Delft, F., Arrowsmith, C.H., Bountra, C., Edwards, A.M., Gileadi, O.

Citation:

Structure of the Ets Domain of Human Etv4 in Complex with DNA
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.202R free:0.247

NDB ID:

NA2955

PDB ID:

4PU3 

Release:

2014-08-06

Title:

Shewanella oneidensis MR-1 Toxin Antitoxin System HipA, HipB and its operator DNA complex (space group P212121)

Classification:

TOXIN/ANTITOXIN/DNA

Authors:

Wen, Y., Behiels, E., Felix, J., Elegheert, J., Vergauwen, B., Devreese, B., Savvides, S.N.

Citation:

The bacterial antitoxin HipB establishes a ternary complex with operator DNA and phosphorylated toxin HipA to regulate bacterial persistence.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.39Å R work:0.256R free:0.315

NDB ID:

NA2956

PDB ID:

4PU4 

Release:

2014-08-06

Title:

Shewanella oneidensis MR-1 Toxin Antitoxin System HipA, HipB and its operator DNA complex (space group P21)

Classification:

TOXIN/ANTITOXIN/DNA

Authors:

Wen, Y., Behiels, E., Felix, J., Elegheert, J., Vergauwen, B., Devreese, B., Savvides, S.N.

Citation:

The bacterial antitoxin HipB establishes a ternary complex with operator DNA and phosphorylated toxin HipA to regulate bacterial persistence.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.786Å R work:0.236R free:0.306

NDB ID:

2MND

PDB ID:

2MND 

Release:

2014-07-30

Title:

Recognition complex of DNA d(CGACGCGTCG)2 with thiazotropsin B

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA Minor Groove by Thiazotropsin Analogues.
Chembiochem pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

2MNE

PDB ID:

2MNE 

Release:

2014-07-30

Title:

Recognition complex of DNA d(CGACTAGTCG)2 with thiazotropsin analogue AIK-18/51

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA Minor Groove by Thiazotropsin Analogues.
Chembiochem pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

2MNF

PDB ID:

2MNF 

Release:

2014-07-30

Title:

AIK-18/51 DNA recognition sequence d(CGACTAGTCG)2

Classification:

DNA

Authors:

Alniss, H.Y., Salvia, M.V., Sadikov, M., Golovchenko, I., Anthony, N.G., Khalaf, A.I., MacKay, S.P., Suckling, C.J., Parkinson, J.A.

Citation:

Recognition of the DNA Minor Groove by Thiazotropsin Analogues.
Chembiochem pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2974

PDB ID:

4PY5 

Release:

2014-07-30

Title:

Protein-nucleic acid complex

Classification:

Hydrolase/DNA/RNA

Authors:

Figiel, M., Nowotny, M.

Citation:

Crystal structure of RNase H3-substrate complex reveals parallel evolution of RNA/DNA hybrid recognition.
Nucleic Acids Res. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.183R free:0.232

NDB ID:

NA2980

PDB ID:

4Q4Z 

Release:

2014-07-30

Title:

RPase complex 1

Classification:

transcription/DNA

Authors:

Basu, R.S., Warner, B.A., Molodtsov, V., Pupov, D., Esyunina, D., Fernandez-Tornero, C., Kulbachinskiy, A., Murakami, K.S.

Citation:

Structural Basis of Transcription Initiation by Bacterial RNA Polymerase holoenzyme.
J.Biol.Chem. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.9Å R work:0.255R free:0.274

NDB ID:

NA3024

PDB ID:

4QEO 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHH DNA, H3(1-15) peptide and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.186R free:0.225

NDB ID:

NA3025

PDB ID:

4QEN 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHH DNA and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.002Å R work:0.175R free:0.211

NDB ID:

NA3026

PDB ID:

4QEP 

Release:

2014-07-30

Title:

crystal structure of KRYPTONITE in complex with mCHG DNA and SAH

Classification:

transcription/DNA

Authors:

Du, J., Johnson, L.M., Groth, M., Feng, S., Hale, C.J., Li, S., Vashisht, A.A., Gallego-Bartolome, J., Wohlschlegel, J.A., Patel, D.J., Jacobsen, S.E.

Citation:

Mechanism of DNA Methylation-Directed Histone Methylation by KRYPTONITE.
Mol.Cell pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.1Å R work:0.21R free:0.25

NDB ID:

NA3082

PDB ID:

4D1Q 

Release:

2014-07-30

Title:

Hermes transposase bound to its terminal inverted repeat

Classification:

PROTEIN-DNA COMPLEX

Authors:

Hickman, A.B., Ewis, H.E., Li, X., Knapp, J.A., Laver, T., Doss, A., Tolun, G., Steven, A.C., Grishaev, A., Bax, A., Atkinson, P.W., Craig, N.L., Dyda, F.

Citation:

Structural Basis of Hat Transposon End Recognition by Hermes, an Octameric DNA Transposase from Musca Domestica.
Cell(Cambridge,Mass.) 158 pp.353 - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.4Å R work:0.211R free:0.254

NDB ID:

2M6W

PDB ID:

2M6W 

Release:

2014-07-23

Title:

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Classification:

DNA

Authors:

Karsisiotis, A., Webba da Silva, M.

Citation:

Programming the Self-Assembly of a DNA G-Quadruplex Architecture
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

NA3068

PDB ID:

4UN3 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.593Å R work:0.217R free:0.252

NDB ID:

NA3069

PDB ID:

4UN4 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target with mismatches at positions 1-2

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.371Å R work:0.216R free:0.248

NDB ID:

NA3070

PDB ID:

4UN5 

Release:

2014-07-23

Title:

Crystal structure of Cas9 bound to PAM-containing DNA target containing mismatches at positions 1-3

Classification:

HYDROLASE/DNA/RNA

Authors:

Anders, C., Niewoehner, O., Duerst, A., Jinek, M.

Citation:

Structural Basis of Pam-Dependent Target DNA Recognition by the Cas9 Endonuclease
Nature pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.214R free:0.246

NDB ID:

2M6V

PDB ID:

2M6V 

Release:

2014-07-16

Title:

Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions

Classification:

DNA

Authors:

Karsisiotis, A., Webba da Silva, M.

Citation:

Programming the Self-Assembly of a DNA G-Quadruplex Architecture
To be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

NA2433

PDB ID:

4K4G 

Release:

2014-07-16

Title:

Ternary crystal structures of human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND L-DCTP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W.J., Suo, Z.

Citation:

Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase lambda.
Proc.Natl.Acad.Sci.USA 111 pp.E3033 - E3042 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.2R free:0.249

NDB ID:

NA2434

PDB ID:

4K4H 

Release:

2014-07-16

Title:

Ternary crystal structures of a human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND (-)3TC-TP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W.J., Suo, Z.

Citation:

Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase lambda.
Proc.Natl.Acad.Sci.USA 111 pp.E3033 - E3042 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.1Å R work:0.204R free:0.259

NDB ID:

NA2435

PDB ID:

4K4I 

Release:

2014-07-16

Title:

Ternary crystal structures of a human DNA POLYMERASE LAMBDA IN COMPLEX WITH DNA AND (-)FTC-TP.

Classification:

TRANSFERASE/DNA

Authors:

Vyas, R., Zahurancik, W.J., Suo, Z.

Citation:

Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase lambda.
Proc.Natl.Acad.Sci.USA 111 pp.E3033 - E3042 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.25Å R work:0.212R free:0.274

NDB ID:

NA2614

PDB ID:

4LQ0 

Release:

2014-07-16

Title:

Crystal structure of the I-LtrWI LAGLIDADG homing endonuclease bound to target DNA.

Classification:

HYDROLASE/DNA

Authors:

Chik, J., Shen, B., Stoddard, B.

Citation:

Structural Comparisons of LAGLIDADG Homing Endonucleases.
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.68Å R work:0.196R free:0.271

NDB ID:

NA2766

PDB ID:

4NHJ 

Release:

2014-07-16

Title:

Crystal structure of Klebsiella pneumoniae RstA DNA-binding domain in complex with RstA box

Classification:

TRANSCRIPTION REGULATOR/DNA

Authors:

Li, Y.C., Chang, C.K., Chang, C.F., Cheng, Y.H., Fang, P.J., Yu, T., Chen, S.C., Li, Y.C., Hsiao, C.D., Huang, T.H.

Citation:

Structural dynamics of the two-component response regulator RstA in recognition of promoter DNA element.
Nucleic Acids Res. 42 pp.8777 - 8788 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.701Å R work:0.216R free:0.271

NDB ID:

NA2982

PDB ID:

4Q5S 

Release:

2014-07-09

Title:

RPase in complex with DNA and RNA

Classification:

transcription/DNA/rna

Authors:

Basu, R.S., Warner, B.A., Molodtsov, V., Pupov, D., Esyunina, D., Fernandez-Tornero, C., Kulbachinskiy, A., Murakami, K.

Citation:

Structural basis of transcription initiation by bacterial RNA polymerase holoenzyme
J.Biol.Chem. pp. - 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.269R free:0.293

NDB ID:

NA3050

PDB ID:

4CJA 

Release:

2014-07-09

Title:

BurrH DNA-binding protein from Burkholderia rhizoxinica in complex with its target DNA

Classification:

TRANSCRIPTION

Authors:

Stella, S., Molina, R., Lopez-Mendez, B., Juillerat, A., Bertonati, C., Daboussi, F., Campos-Olivas, R., Duchateau, P., Montoya, G.

Citation:

Bud, a Helix-Loop-Helix DNA-Binding Domain for Genome Modification
Acta Crystallogr.,Sect.D 70 pp.2042 - 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.651Å R work:0.202R free:0.267

NDB ID:

2MH6

PDB ID:

2MH6 

Release:

2014-07-02

Title:

Solution structure of DNA duplex containing N3T-ethylene-N1I interstrand cross-link

Classification:

DNA

Authors:

O'Flaherty, D.K., Denisov, A.Y., Noronha, A.M., Wilds, C.J.

Citation:

NMR Structure of an Ethylene Interstrand Cross-Linked DNA which Mimics the Lesion Formed by 1,3-Bis(2-chloroethyl)-1-nitrosourea.
Chemmedchem pp. - 2014

Experiment:

SOLUTION NMR

NDB ID:

NA2546

PDB ID:

4L5K 

Release:

2014-07-02

Title:

Crystal structure of the complex of DNA hexamer d(CGATCG) with Coptisine

Classification:

DNA

Authors:

Ferraroni, M., Bazzicalupi, C., Gratteri, P.

Citation:

Crystal structure of the complex of DNA hexamer d(CGATCG) with Coptisine
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.71Å R work:0.267

NDB ID:

NA2591

PDB ID:

4LG0 

Release:

2014-07-02

Title:

Structure of a ternary FOXO1-ETS1 DNA complex

Classification:

TRANSCRIPTION/DNA

Authors:

Birrane, G., Choy, W.C., Datta, D., Geiger, C.A., Grant, M.A.

Citation:

Structure of a ternary FOXO1-ETS1 DNA complex
To be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.19Å R work:0.194R free:0.243

NDB ID:

NA2818

PDB ID:

4O5C 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7-MG as the template base in a 1-nucleotide gapped DNA

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine.
Nucleic Acids Res. 42 pp.8755 - 8766 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.363Å R work:0.2R free:0.245

NDB ID:

NA2819

PDB ID:

4O5E 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7MG in the template base paired with incoming non-hydrolyzable TTP

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine.
Nucleic Acids Res. 42 pp.8755 - 8766 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.532Å R work:0.205R free:0.272

NDB ID:

NA2820

PDB ID:

4O5K 

Release:

2014-07-02

Title:

Structure of human DNA polymerase complexed with N7MG in the template base paired with incoming non-hydrolyzable CTP

Classification:

Transferase, Lyase/DNA

Authors:

Koag, M.C., Kou, Y., Ouzon-Shubeita, H., Lee, S.

Citation:

Transition-state destabilization reveals how human DNA polymerase beta proceeds across the chemically unstable lesion N7-methylguanine.
Nucleic Acids Res. 42 pp.8755 - 8766 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.058Å R work:0.2R free:0.251

NDB ID:

NA2869

PDB ID:

4O5W 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.6Å R work:0.224R free:0.255

NDB ID:

NA2870

PDB ID:

4O5X 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine.

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.6Å R work:0.247R free:0.268

NDB ID:

NA2871

PDB ID:

4O5Y 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.75Å R work:0.228R free:0.268

NDB ID:

NA2872

PDB ID:

4O5Z 

Release:

2014-07-02

Title:

O6-carboxymethylguanine in DNA forms a sequence context dependent wobble base pair structure with thymine

Classification:

DNA

Authors:

Zhang, F., Tsunoda, M., Kikuchi, Y., Wilkinson, O., Millington, C.L., Margison, G.P., Williams, D.M., Takenaka, A.

Citation:

O(6)-Carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine
Acta Crystallogr.,Sect.D 70 pp.1669 - 1679 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.75Å R work:0.227R free:0.263

NDB ID:

NA2912

PDB ID:

4OPX 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2R)-5-fluoro-2-methyl-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.314Å R work:0.302R free:0.324

NDB ID:

NA2913

PDB ID:

4OQA 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2Z)-2-(2,4-dihydroxybenzylidene)-3-oxo-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.65Å R work:0.298R free:0.334

NDB ID:

NA2914

PDB ID:

4OQB 

Release:

2014-07-02

Title:

Structure of Human PARP-1 bound to a DNA double strand break in complex with (2Z)-2-{4-[2-(morpholin-4-yl)ethoxy]benzylidene}-3-oxo-2,3-dihydro-1-benzofuran-7-carboxamide

Classification:

TRANSFERASE/DNA/TRANSFERASE INHIBITOR

Authors:

Patel, M.R., Bhatt, A., Steffen, J.D., Chergui, A., Murai, J., Pommier, Y., Pascal, J.M., Trombetta, L.D., Fronczek, F.R., Talele, T.T.

Citation:

Discovery and Structure-Activity Relationship of Novel 2,3-Dihydrobenzofuran-7-carboxamide and 2,3-Dihydrobenzofuran-3(2H)-one-7-carboxamide Derivatives as Poly(ADP-ribose)polymerase-1 Inhibitors.
J.Med.Chem. 57 pp.5579 - 5601 2014

Experiment:

X-RAY DIFFRACTION Resolution:3.362Å R work:0.321R free:0.349

NDB ID:

NA2966

PDB ID:

4PXI 

Release:

2014-07-02

Title:

Elucidation of the Structural and Functional Mechanism of Action of the TetR Family Protein, CprB from S. coelicolor A3(2)

Classification:

TRANSCRIPTION/DNA

Authors:

Hussain, B., Ruchika, B., Aruna, B., Ruchi, A.

Citation:

Structural and functional basis of transcriptional regulation by TetR family protein CprB from S. coelicolor A3(2)
Nucleic Acids Res. pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.219R free:0.294

NDB ID:

NA2988

PDB ID:

4Q8E 

Release:

2014-07-02

Title:

Human DNA polymerase eta inserting dCMPNPP opposite a phenanthriplatin adducted G

Classification:

TRANSFERASE/DNA

Authors:

Gregory, M.T., Park, G.Y., Johnstone, T.C., Lee, Y.S., Yang, W., Lippard, S.J.

Citation:

Structural and mechanistic studies of polymerase eta bypass of phenanthriplatin DNA damage.
Proc.Natl.Acad.Sci.USA 111 pp.9133 - 9138 2014

Experiment:

X-RAY DIFFRACTION Resolution:1.549Å R work:0.183R free:0.225

NDB ID:

NA2989

PDB ID:

4Q8F 

Release:

2014-07-02

Title:

Human DNA polymerase eta extending primer immediately after a phenanthriplatin adducted G

Classification:

TRANSFERASE/DNA

Authors:

Gregory, M.T., Park, G.Y., Johnstone, T.C., Lee, Y.S., Yang, W., Lippard, S.J.

Citation:

Structural and mechanistic studies of polymerase eta bypass of phenanthriplatin DNA damage.
Proc.Natl.Acad.Sci.USA 111 pp.9133 - 9138 2014

Experiment:

X-RAY DIFFRACTION Resolution:2.797Å R work:0.195R free:0.243