A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 17-May-2017 number of released structures: 8874
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 5992  Download results as an excel file       Gallery view

NDB ID:

5LUX

PDB ID:

5LUX 

Release:

2017-05-17

Title:

Homeobox transcription factor CDX1 bound to methylated DNA

Classification:

TRANSCRIPTION

Authors:

Yin, Y., Morgunova, E., Jolma, A., Kaasinen, E., Sahu, B., Khund-Sayeed, S., Das, P.K., Kivioja, T., Dave, K., Zhong, F., Nitta, K.R., Taipale, M., Popov, A., Ginno, P.A., Domcke, S., Yan, J., Schubeler, D., Vinson, C., Taipale, J.

Citation:

Impact of cytosine methylation on DNA binding specificities of human transcription factors.
Science 356 pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.23Å R work:0.241R free:0.299

NDB ID:

5NL0

PDB ID:

5NL0 

Release:

2017-05-17

Title:

Crystal structure of a 197-bp palindromic 601L nucleosome in complex with linker histone H1

Classification:

CHROMATIN BINDING PROTEIN / DNA

Authors:

Bednar, J., Garcia-Saez, I., Boopathi, R., Cutter, A.R., Papai, G., Reymer, A., Syed, S.H., Lone, I.N., Tonchev, O., Crucifix, C., Menoni, H., Papin, C., Skoufias, D.A., Kurumizaka, H., Lavery, R., Hamiche, A., Hayes, J.J., Schultz, P., Angelov, D., Petosa, C., Dimitrov, S.

Citation:

Structure and Dynamics of a 197 bp Nucleosome in Complex with Linker Histone H1.
Mol. Cell 66 pp.384 - 397.e8 2017

Experiment:

X-RAY DIFFRACTION Resolution:5.4Å R work:0.239R free:0.265

NDB ID:

5T4I

PDB ID:

5T4I 

Release:

2017-05-17

Title:

A Novel domain in human EXOG converts apoptotic endonuclease to DNA-repair enzyme

Classification:

HYDROLASE/DNA

Authors:

Szymanski, M.R., Yu, W., Gmyrek, A.M., White, M.A., Molineux, I.J., Lee, J.C., Yin, Y.W.

Citation:

A domain in human EXOG converts apoptotic endonuclease to DNA-repair exonuclease.
Nat Commun 8 pp.14959 - 14959 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.389Å R work:0.19R free:0.228

NDB ID:

5T5C

PDB ID:

5T5C 

Release:

2017-05-17

Title:

A Novel domain in human EXOG converts apoptotic endonuclease to DNA-repair enzyme

Classification:

HYDROLASE/DNA

Authors:

Szymanski, M.R., Yu, W., Gmyrek, A.M., White, M.A., Molineux, I.J., Lee, J.C., Yin, Y.W.

Citation:

A domain in human EXOG converts apoptotic endonuclease to DNA-repair exonuclease.
Nat Commun 8 pp.14959 - 14959 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.851Å R work:0.185R free:0.215

NDB ID:

5GNJ

PDB ID:

5GNJ 

Release:

2017-05-10

Title:

Structure of a transcription factor and DNA complex

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Lian, T., Xu, Y., Su, X.

Citation:

Crystal Structure of tetrameric Arabidopsis MYC2 reveals the mechanism of enhanced interaction with DNA
Cell Rep pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.205R free:0.273

NDB ID:

5J6U

PDB ID:

5J6U 

Release:

2017-05-10

Title:

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Classification:

DNA

Authors:

Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.

Citation:

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5KEG

PDB ID:

5KEG 

Release:

2017-05-10

Title:

Crystal structure of APOBEC3A in complex with a single-stranded DNA

Classification:

HYDROLASE/DNA

Authors:

Kouno, T., Silvas, T.V., Hilbert, B.J., Shandilya, S.M.D., Bohn, M.F., Kelch, B.A., Royer, W.E., Somasundaran, M., Kurt Yilmaz, N., Matsuo, H., Schiffer, C.A.

Citation:

Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity.
Nat Commun 8 pp.15024 - 15024 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.177R free:0.224

NDB ID:

5LCL

PDB ID:

5LCL 

Release:

2017-05-10

Title:

STRUCTURE OF the RAD14 DNA-binding domain IN COMPLEX WITH C8-aminofluorene- GUANINE CONTAINING DNA

Classification:

DNA BINDING PROTEIN

Authors:

Ebert, C., Simon, N., Schneider, S., Carell, T.

Citation:

Structural insights into the recognition of N2-aryl- and C8-aryl DNA lesions by the repair protein XPA/Rad14.
Chembiochem pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.216R free:0.255

NDB ID:

5LCM

PDB ID:

5LCM 

Release:

2017-05-10

Title:

STRUCTURE OF the RAD14 DNA-binding domain IN COMPLEX WITH N2-acetylaminonaphtyl- GUANINE CONTAINING DNA

Classification:

DNA BINDING PROTEIN

Authors:

Ebert, C., Simon, N., Schneider, S., Carell, T.

Citation:

Structural insights into the recognition of N2-aryl- and C8-aryl DNA lesions by the repair protein XPA/Rad14.
Chembiochem pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.9Å R work:0.231R free:0.268

NDB ID:

5MLU

PDB ID:

5MLU 

Release:

2017-05-10

Title:

Crystal structure of the PFV GAG CBS bound to a mononucleosome

Classification:

DNA BINDING PROTEIN

Authors:

Lesbats, P., Serrao, E., Maskell, D.P., Pye, V.E., Lindemann, D., Engelman, A.N., Cherepanov, P.

Citation:

Structural basis for spumavirus GAG tethering to chromatin
Proc.Natl.Acad.Sci.Usa pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.208R free:0.251

NDB ID:

5MVK

PDB ID:

5MVK 

Release:

2017-05-10

Title:

Crystal structure of an unmodified A-DNA dodecamer containing 3 consecutive CpG steps

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.531Å R work:0.18R free:0.187

NDB ID:

5MVL

PDB ID:

5MVL 

Release:

2017-05-10

Title:

Crystal structure of an A-DNA dodecamer containing 5-bromouracil

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.405Å R work:0.156R free:0.182

NDB ID:

5MVP

PDB ID:

5MVP 

Release:

2017-05-10

Title:

Crystal structure of an A-DNA dodecamer containing the GGGCCC motif

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.606Å R work:0.152R free:0.208

NDB ID:

5MVQ

PDB ID:

5MVQ 

Release:

2017-05-10

Title:

Crystal structure of an unmodified, self-complementary dodecamer.

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.604Å R work:0.178R free:0.193

NDB ID:

5MVT

PDB ID:

5MVT 

Release:

2017-05-10

Title:

Crystal structure of an A-DNA dodecamer featuring an alternating pyrimidine-purine sequence

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.896Å R work:0.201R free:0.224

NDB ID:

5MVU

PDB ID:

5MVU 

Release:

2017-05-10

Title:

Crystal structure of an A-DNA dodecamer containing 5-formylcytosine in 3 consecutive CpG steps

Classification:

DNA

Authors:

Hardwick, J.S., Ptchelkine, D., El-Sagheer, A.H., Tear, I., Singleton, D., Phillips, S.E.V., Lane, A.N., Brown, T.

Citation:

5-formylcytosine does not change the global structure of DNA
Nat.Struct.Mol.Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.3Å R work:0.148R free:0.157

NDB ID:

5V1F

PDB ID:

5V1F 

Release:

2017-05-10

Title:

DNA polymerase beta substrate complex with 8-oxoG at the primer terminus and incoming dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.181Å R work:0.226R free:0.296

NDB ID:

5V1G

PDB ID:

5V1G 

Release:

2017-05-10

Title:

DNA polymerase beta binary complex with 8-oxoG at the primer terminus

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.798Å R work:0.186R free:0.227

NDB ID:

5V1H

PDB ID:

5V1H 

Release:

2017-05-10

Title:

DNA polymerase beta binary complex with 8-oxoG:A at the primer terminus

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.946Å R work:0.219R free:0.272

NDB ID:

5V1I

PDB ID:

5V1I 

Release:

2017-05-10

Title:

DNA polymerase beta ternary product complex with 8-oxoG:C and inserted dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.035Å R work:0.184R free:0.237

NDB ID:

5V1J

PDB ID:

5V1J 

Release:

2017-05-10

Title:

DNA polymerase beta open product complex with 8-oxoG:C and inserted dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.616Å R work:0.217R free:0.285

NDB ID:

5V1N

PDB ID:

5V1N 

Release:

2017-05-10

Title:

DNA polymerase beta substrate complex with 8-oxoG:A at the primer terminus and incoming dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.005Å R work:0.18R free:0.236

NDB ID:

5V1O

PDB ID:

5V1O 

Release:

2017-05-10

Title:

DNA polymerase beta product complex with 8-oxoG:A and inserted dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.801Å R work:0.178R free:0.215

NDB ID:

5V1P

PDB ID:

5V1P 

Release:

2017-05-10

Title:

DNA polymerase beta substrate complex with 8-oxoG:C at the primer terminus and incoming dCTP analog

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.991Å R work:0.175R free:0.231

NDB ID:

5V1R

PDB ID:

5V1R 

Release:

2017-05-10

Title:

DNA polymerase beta reactant complex with 8-oxoG:C at the primer terminus and incoming dCTP

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.077Å R work:0.179R free:0.236

NDB ID:

5VEZ

PDB ID:

5VEZ 

Release:

2017-05-10

Title:

DNA polymerase beta substrate complex with 8-oxoG:A at the primer terminus and incoming dCTP analog

Classification:

TRANSFERASE/DNA, LIGASE/DNA

Authors:

Whitaker, A.M., Smith, M.R., Schaich, M.A., Freudenthal, B.D.

Citation:

Capturing a mammalian DNA polymerase extending from an oxidized nucleotide.
Nucleic Acids Res. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.039Å R work:0.187R free:0.231

NDB ID:

5GSE

PDB ID:

5GSE 

Release:

2017-05-03

Title:

Crystal structure of unusual nucleosome

Classification:

STRUCTURAL PROTEIN/DNA

Authors:

Kato, D., Osakabe, A., Arimura, Y., Mizukami, Y., Horikoshi, N., Saikusa, K., Akashi, S., Nishimura, Y., Park, S.Y., Nogami, J., Maehara, K., Ohkawa, Y., Matsumoto, A., Kono, H., Inoue, R., Sugiyama, M., Kurumizaka, H.

Citation:

Crystal structure of the overlapping dinucleosome composed of hexasome and octasome
Science 356 pp.205 - 208 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.14Å R work:0.197R free:0.255

NDB ID:

5H58

PDB ID:

5H58 

Release:

2017-05-03

Title:

Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence

Classification:

TRANSCRIPTION/DNA

Authors:

Bhukya, H., Jana, A.K., Sengupta, N., Anand, R.

Citation:

Structural and dynamics studies of the TetR family protein, CprB from Streptomyces coelicolor in complex with its biological operator sequence
J. Struct. Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.991Å R work:0.216R free:0.281

NDB ID:

5JLT

PDB ID:

5JLT 

Release:

2017-05-03

Title:

The crystal structure of the bacteriophage T4 MotA C-terminal domain in complex with dsDNA reveals a novel protein-DNA recognition motif

Classification:

VIRAL PROTEIN/DNA

Authors:

Robertson, R.M., Cuypers, M.G., Waddell, M.B., Vaithiyalingam, S., Kreuzer, K.N., Hinton, D.M., White, S.B.

Citation:

The crystal structure of the bacteriophage T4 MotA C-terminal domain in complex with dsDNA reveals a novel protein-DNA recognition motif
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.955Å R work:0.219R free:0.244

NDB ID:

5KTV

PDB ID:

5KTV 

Release:

2017-05-03

Title:

Mis-pairing of unnatural base Z-G DNA duplex at pH 8.5

Classification:

DNA

Authors:

Reichenbach, L.F., Ahmad Sobri, A.F., Zaccai, N.R., Agnew, C., Burton, N., Eperon, L.P., de Ornellas, S., Eperon, I.C., Brady, R.L., Burley, G.A.

Citation:

Structural Basis of the Mispairing of an Artificially Expanded Genetic Information System
Chemistry pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.18R free:0.237

NDB ID:

5LJ4

PDB ID:

5LJ4 

Release:

2017-05-03

Title:

Crystal structure of DNA duplex containing ZP base pair

Classification:

DNA

Authors:

Reichenbach, L.F., Sobri, A.A., Zaccai, N.R., Agnew, C.R.J., Burton, N., Eperon, L.P., de Ornellas, S., Eperon, I.C., Brady, R.L., Burley, G.A.

Citation:

Structural Basis of the Mispairing of an Artificially Expanded Genetic Information System
Chem 1 pp.946 - 958 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.17Å R work:0.219R free:0.274

NDB ID:

5T2H

PDB ID:

5T2H 

Release:

2017-05-03

Title:

Engineered variant of I-OnuI meganuclease targeting the Human TCRa gene; harbors 43 point mutations relative to wild-type I-OnuI

Classification:

HYDROLASE/DNA

Authors:

Stoddard, B.L.

Citation:

TBD
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.517Å R work:0.211R free:0.265

NDB ID:

5T2N

PDB ID:

5T2N 

Release:

2017-05-03

Title:

Engineered variant of I-OnuI meganuclease targeting the Anopheles AGAP007280 gene; harbors 38 point mutations relative to wild-type I-OnuI

Classification:

Hydrolase/DNA

Authors:

Stoddard, B.L., Werther, R.

Citation:

TBD
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.079Å R work:0.219R free:0.257

NDB ID:

5T2O

PDB ID:

5T2O 

Release:

2017-05-03

Title:

Engineered variant of I-OnuI meganuclease targeting the Anopheles AGAP011377 gene; harbors 53 point mutations relative to wild-type I-OnuI

Classification:

Hydrolase/DNA

Authors:

Stoddard, B.L., Werther, R.

Citation:

TBD
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.801Å R work:0.224R free:0.28

NDB ID:

5T8D

PDB ID:

5T8D 

Release:

2017-05-03

Title:

Engineered variant of I-OnuI meganuclease targeting the HIV integrase gene; harbors 47 point mutations relative to wild-type I-OnuI

Classification:

HYDROLASE/DNA

Authors:

Stoddard, B.L.

Citation:

TBD
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.182R free:0.228

NDB ID:

5THG

PDB ID:

5THG 

Release:

2017-05-03

Title:

Engineered variant of I-OnuI meganuclease targeting the HIV CCR5 gene; harbors 43 point mutations relative to wild-type I-OnuI

Classification:

HYDROLASE/DNA

Authors:

Werther, R., Hallinan, J.P., Lambert, A., Haven, K., Jarjor, J., Stoddard, B.L.

Citation:

The structural basis of altered gene specificity resulting from meganuclease and MegaTAL engineering
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.106Å R work:0.22R free:0.278

NDB ID:

5UX0

PDB ID:

5UX0 

Release:

2017-05-03

Title:

X-ray crystal structure of Marinitoga piezophila Argonaute in complex with 5' OH guide RNA and target DNA

Classification:

HYDROLASE/RNA/DNA

Authors:

Doudna, J.A., Doxzen, K.W.

Citation:

X-ray crystal structure of Marinitoga piezophila Argonaute in complex with 5' OH guide RNA and target DNA
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.197Å R work:0.215R free:0.258

NDB ID:

5EG6

PDB ID:

5EG6 

Release:

2017-04-26

Title:

CSL-RITA complex bound to DNA

Classification:

TRANSCRIPTION/DNA BINDING PROTEIN/DNA

Authors:

Tabaja, N.H., Kovall, R.A.

Citation:

CSL-RITA complex bound to DNA
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.094Å R work:0.197R free:0.238

NDB ID:

5NNX

PDB ID:

5NNX 

Release:

2017-04-26

Title:

TEAD1 bound to DNA

Classification:

TRANSCRIPTION

Authors:

Morgunova, E., Jolma, A., Yin, Y., Popov, A., Taipale, J.

Citation:

TEAD1 bound to DNA
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.29Å R work:0.195R free:0.277

NDB ID:

5U8G

PDB ID:

5U8G 

Release:

2017-04-26

Title:

DNA Polymerase Beta crystallized in PEG 400

Classification:

TRANSFERASE,LYASE/DNA

Authors:

Eckenroth, B.E., Towle-Weicksel, J.B., Nemec, A.A., Murphy, D.L., Sweasy, J.B., Doublie, S.

Citation:

Remote Mutations Induce Functional Changes in Active Site Residues of Human DNA Polymerase beta.
Biochemistry 56 pp.2363 - 2371 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.166Å R work:0.179R free:0.224

NDB ID:

5U8H

PDB ID:

5U8H 

Release:

2017-04-26

Title:

DNA Polymerase Beta G231D crystallized in PEG 400

Classification:

TRANSFERASE,LYASE/DNA

Authors:

Eckenroth, B.E., Towle-Weicksel, J.B., Nemec, A.A., Murphy, D.L., Sweasy, J.B., Doublie, S.

Citation:

Remote Mutations Induce Functional Changes in Active Site Residues of Human DNA Polymerase beta.
Biochemistry 56 pp.2363 - 2371 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.155Å R work:0.181R free:0.233

NDB ID:

5U8I

PDB ID:

5U8I 

Release:

2017-04-26

Title:

DNA Polymerase Beta S229L crystallized in PEG 400

Classification:

TRANSFERASE,LYASE/DNA

Authors:

Eckenroth, B.E., Towle-Weicksel, J.B., Nemec, A.A., Murphy, D.L., Sweasy, J.B., Doublie, S.

Citation:

Remote Mutations Induce Functional Changes in Active Site Residues of Human DNA Polymerase beta.
Biochemistry 56 pp.2363 - 2371 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.45Å R work:0.183R free:0.23

NDB ID:

5VI8

PDB ID:

5VI8 

Release:

2017-04-26

Title:

Structure of a mycobacterium smegmatis transcription initiation complex with an upstream-fork promoter fragment

Classification:

TRANSCRIPTION

Authors:

Hubin, E.A., Fay, A., Xu, C., Bean, J.M., Saecker, R.M., Glickman, M.S., Darst, S.A., Campbell, E.A.

Citation:

Structure and function of the mycobacterial transcription initiation complex with the essential regulator RbpA.
Elife 6 pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.76Å R work:0.24R free:0.28

NDB ID:

5WVW

PDB ID:

5WVW 

Release:

2017-04-26

Title:

The crystal structure of Cren7 mutant L28A in complex with dsDNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Zhang, Z., Zhao, M., Wang, L., Chen, Y., Dong, Y., Gong, Y., Huang, L.

Citation:

Roles of Leu28 side chain intercalation in the interaction between Cren7 and DNA
Biochem. J. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.8Å R work:0.184R free:0.203

NDB ID:

5WVY

PDB ID:

5WVY 

Release:

2017-04-26

Title:

The crystal structure of Cren7 mutant L28V in complex with dsDNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Zhang, Z., Zhao, M., Wang, L., Chen, Y., Dong, Y., Gong, Y., Huang, L.

Citation:

Roles of Leu28 side chain intercalation in the interaction between Cren7 and DNA
Biochem. J. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.174R free:0.236

NDB ID:

5WVZ

PDB ID:

5WVZ 

Release:

2017-04-26

Title:

The crystal structure of Cren7 mutant L28F in complex with dsDNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Zhang, Z., Zhao, M., Wang, L., Chen, Y., Dong, Y., Gong, Y., Huang, L.

Citation:

Roles of Leu28 side chain intercalation in the interaction between Cren7 and DNA
Biochem. J. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.3Å R work:0.201R free:0.237

NDB ID:

5WWC

PDB ID:

5WWC 

Release:

2017-04-26

Title:

The crystal structure of Cren7 mutant L28M in complex with dsDNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Zhang, Z., Zhao, M., Wang, L., Chen, Y., Dong, Y., Gong, Y., Huang, L.

Citation:

Roles of Leu28 side chain intercalation in the interaction between Cren7 and DNA
Biochem. J. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.9Å R work:0.197R free:0.234

NDB ID:

5GXQ

PDB ID:

5GXQ 

Release:

2017-04-19

Title:

The crystal structure of the nucleosome containing H3.6

Classification:

STRUCTURAL PROTEIN/DNA

Authors:

Taguchi, H., Xie, Y., Horikoshi, N., Maehara, K., Harada, A., Nogami, J., Sato, K., Arimura, Y., Osakabe, A., Kujirai, T., Iwasaki, T., Semba, Y., Tachibana, T., Kimura, H., Ohkawa, Y., Kurumizaka, H.

Citation:

Crystal Structure and Characterization of Novel Human Histone H3 Variants, H3.6, H3.7, and H3.8
Biochemistry 56 pp.2184 - 2196 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.85Å R work:0.219R free:0.261

NDB ID:

5GZB

PDB ID:

5GZB 

Release:

2017-04-19

Title:

Crystal Structure of Transcription Factor TEAD4 in Complex with M-CAT DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shi, Z.B., He, F., Chen, M., Hua, L., Wang, W., Jiao, S., Zhou, Z.C.

Citation:

DNA-binding mechanism of the Hippo pathway transcription factor TEAD4
Oncogene pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.704Å R work:0.229R free:0.256

NDB ID:

5MBR

PDB ID:

5MBR 

Release:

2017-04-19

Title:

Quadruplex with flipped tetrad formed by a human telomeric sequence

Classification:

DNA

Authors:

Dickerhoff, J., Haase, L., Langel, W., Weisz, K.

Citation:

Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes.
ACS Chem. Biol. pp. - 2017

Experiment:

SOLUTION NMR