A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 19-Apr-2017 number of released structures: 8825
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 5945  Download results as an excel file       Gallery view

NDB ID:

5GXQ

PDB ID:

5GXQ 

Release:

2017-04-19

Title:

The crystal structure of the nucleosome containing H3.6

Classification:

STRUCTURAL PROTEIN/DNA

Authors:

Taguchi, H., Xie, Y., Horikoshi, N., Maehara, K., Harada, A., Nogami, J., Sato, K., Arimura, Y., Osakabe, A., Kujirai, T., Iwasaki, T., Semba, Y., Tachibana, T., Kimura, H., Ohkawa, Y., Kurumizaka, H.

Citation:

Crystal Structure and Characterization of Novel Human Histone H3 Variants, H3.6, H3.7, and H3.8
Biochemistry pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.85Å R work:0.219R free:0.261

NDB ID:

5GZB

PDB ID:

5GZB 

Release:

2017-04-19

Title:

Crystal Structure of Transcription Factor TEAD4 in Complex with M-CAT DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Shi, Z.B., He, F., Chen, M., Hua, L., Wang, W., Jiao, S., Zhou, Z.C.

Citation:

DNA-binding mechanism of the Hippo pathway transcription factor TEAD4
Oncogene pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.704Å R work:0.229R free:0.256

NDB ID:

5MBR

PDB ID:

5MBR 

Release:

2017-04-19

Title:

Quadruplex with flipped tetrad formed by a human telomeric sequence

Classification:

DNA

Authors:

Dickerhoff, J., Haase, L., Langel, W., Weisz, K.

Citation:

Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes.
ACS Chem. Biol. pp. - 2017

Experiment:

SOLUTION NMR

NDB ID:

5MCR

PDB ID:

5MCR 

Release:

2017-04-19

Title:

Quadruplex with flipped tetrad formed by an artificial sequence

Classification:

DNA

Authors:

Dickerhoff, J., Haase, L., Langel, W., Weisz, K.

Citation:

Tracing Effects of Fluorine Substitutions on G-Quadruplex Conformational Changes.
ACS Chem. Biol. pp. - 2017

Experiment:

SOLUTION NMR

NDB ID:

5U1J

PDB ID:

5U1J 

Release:

2017-04-19

Title:

Structure of pNOB8 ParA bound to nonspecific DNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Zhang, H., Schumacher, M.A.

Citation:

Structures of partition protein ParA with nonspecific DNA and ParB effector reveal molecular insights into principles governing Walker-box DNA segregation.
Genes Dev. 31 pp.481 - 492 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.95Å R work:0.22R free:0.247

NDB ID:

5ULW

PDB ID:

5ULW 

Release:

2017-04-19

Title:

Structure of human DNA polymerase iota bound to template 1-methyl-deoxyadenosine

Classification:

Thansferase/DNA

Authors:

Jain, R., Choudhury, J.R., Buku, A., Johnson, R.E., Prakash, L., Prakash, S., Aggarwal, A.K.

Citation:

Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-iota.
Sci Rep 7 pp.43904 - 43904 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.617Å R work:0.203R free:0.248

NDB ID:

5ULX

PDB ID:

5ULX 

Release:

2017-04-19

Title:

Structure of human DNA polymerase iota bound to template 1-methyl-deoxyadenosine crystallized in the presence of dCTP

Classification:

Thansferase/DNA

Authors:

Jain, R., Choudhury, J.R., Buku, A., Johnson, R.E., Prakash, L., Prakash, S., Aggarwal, A.K.

Citation:

Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-iota.
Sci Rep 7 pp.43904 - 43904 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.96Å R work:0.216R free:0.238

NDB ID:

5V0L

PDB ID:

5V0L 

Release:

2017-04-19

Title:

Crystal structure of the AHR-ARNT heterodimer in complex with the DRE

Classification:

TRANSCRIPTION/DNA

Authors:

Seok, S.-H., Lee, W., Jiang, L., Molugu, K., Zheng, A., Li, Y., Park, S., Bradfield, C.A., Xing, Y.

Citation:

Structural Hierarchy Controlling Dimerization and Target DNA Recognition in AHR Transcriptional Complex
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:4.0Å R work:0.285R free:0.322

NDB ID:

5X7X

PDB ID:

5X7X 

Release:

2017-04-19

Title:

The crystal structure of the nucleosome containing H3.3 at 2.18 angstrom resolution

Classification:

STRUCTURAL PROTEIN/DNA

Authors:

Taguchi, H., Xie, Y., Horikoshi, N., Maehara, K., Harada, A., Nogami, J., Sato, K., Arimura, Y., Osakabe, A., Kujirai, T., Iwasaki, T., Semba, Y., Tachibana, T., Kimura, H., Ohkawa, Y., Kurumizaka, H.

Citation:

Crystal Structure and Characterization of Novel Human Histone H3 Variants, H3.6, H3.7, and H3.8
Biochemistry pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.184Å R work:0.226R free:0.255

NDB ID:

5J2Y

PDB ID:

5J2Y 

Release:

2017-04-12

Title:

Molecular insight into the regulatory mechanism of the quorum-sensing repressor RsaL in Pseudomonas aeruginosa

Classification:

GENE REGULATION/DNA

Authors:

Zhao, J., Gan, J., Zhang, J., Kang, H., Kong, W., Zhu, M., Li, F., Song, Y., Qin, J., Liang, H.

Citation:

Molecular insight into the regulatory mechanism of the quorum-sensing repressor RsaL in Pseudomonas aeruginosa
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.223R free:0.251

NDB ID:

5J4W

PDB ID:

5J4W 

Release:

2017-04-12

Title:

DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium

Classification:

DNA

Authors:

Dvorkin, S.A., Webba da Silva, M.

Citation:

DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5N2Q

PDB ID:

5N2Q 

Release:

2017-04-12

Title:

MobM Relaxase Domain (MOBV; Mob_Pre) bound to 26nt pMV158 oriT DNA

Classification:

DNA BINDING PROTEIN

Authors:

Russi, S., Boer, D.R., Coll, M.

Citation:

MobM Relaxase Domain (MOBV; Mob_Pre) bound to 26nt pMV158 oriT DNA
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.166R free:0.238

NDB ID:

5UH5

PDB ID:

5UH5 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 3 nt of RNA

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.746Å R work:0.193R free:0.248

NDB ID:

5UH6

PDB ID:

5UH6 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 2ntRNA in complex with Rifampin

Classification:

transcription/dna/rna/antibiotic

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.837Å R work:0.211R free:0.263

NDB ID:

5UH8

PDB ID:

5UH8 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 4nt RNA

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.176Å R work:0.2R free:0.256

NDB ID:

5UH9

PDB ID:

5UH9 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 2nt RNA

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.402Å R work:0.281R free:0.331

NDB ID:

5UHA

PDB ID:

5UHA 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex

Classification:

TRANSCRIPTION/DNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.906Å R work:0.211R free:0.279

NDB ID:

5UHB

PDB ID:

5UHB 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex in complex with Rifampin

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.29Å R work:0.208R free:0.266

NDB ID:

5UHC

PDB ID:

5UHC 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 3nt RNA in complex with Rifampin

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.796Å R work:0.204R free:0.266

NDB ID:

5UHD

PDB ID:

5UHD 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex containing 4nt RNA in complex with Rifampin

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.01Å R work:0.21R free:0.264

NDB ID:

5UHE

PDB ID:

5UHE 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex in complex with D-AAP1

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.039Å R work:0.209R free:0.259

NDB ID:

5UHF

PDB ID:

5UHF 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex in complex with D-IX336

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:4.345Å R work:0.197R free:0.266

NDB ID:

5UHG

PDB ID:

5UHG 

Release:

2017-04-12

Title:

Crystal structure of Mycobacterium tuberculosis transcription initiation complex in complex with D-AAP1 and Rifampin

Classification:

TRANSCRIPTION/DNA/RNA

Authors:

Lin, W., Mandal, S., Degen, D., Yu, L., Ebright, Y.W., Li, S., Feng, Y., Zhang, Y., Mandal, S., Jiang, Y., Liu, S., Gigliotti, M., Talaue, M., Connell, N., Das, K., Arnold, E., Ebright, R.H.

Citation:

Structural Basis of Mycobacterium tuberculosis Transcription and Transcription Inhibition
Mol.Cell pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:3.971Å R work:0.222R free:0.26

NDB ID:

5X6D

PDB ID:

5X6D 

Release:

2017-04-12

Title:

Crystal structure of PrfA-DNA binary complex

Classification:

DNA BINDING PROTEN/DNA

Authors:

Wang, Y., Feng, H., Zhu, Y., Gao, P.

Citation:

Structural insights into glutathione-mediated activation of the master regulator PrfA in Listeria monocytogenes
Protein Cell 8 pp.308 - 312 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.94Å R work:0.213R free:0.265

NDB ID:

5X6E

PDB ID:

5X6E 

Release:

2017-04-12

Title:

Crystal structure of PrfA-DNA binary complex

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Wang, Y., Feng, H., Zhu, Y., Gao, P.

Citation:

Structural insights into glutathione-mediated activation of the master regulator PrfA in Listeria monocytogenes
Protein Cell 8 pp.308 - 312 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.99Å R work:0.248R free:0.299

NDB ID:

5IWJ

PDB ID:

5IWJ 

Release:

2017-04-05

Title:

LAmbda-[Ru(TAP)2(dppz)]2+ bound to d(CCGGGCCCGG

Classification:

DNA

Authors:

Souter, J.E., Hall, J.P., Gurung, S.P., Brazier, J.A., Cardin, C.J.

Citation:

The binding specificity of RuTAP2dppz
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.88Å R work:0.21R free:0.277

NDB ID:

5J05

PDB ID:

5J05 

Release:

2017-04-05

Title:

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

Classification:

DNA

Authors:

Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.

Citation:

DIY G-Quadruplexes
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5TXL

PDB ID:

5TXL 

Release:

2017-04-05

Title:

STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE (RT) TERNARY COMPLEX WITH A DOUBLE STRANDED DNA AND AN INCOMING DATP

Classification:

TRANSFERASE/DNA

Authors:

Das, K., Martinez, S.M., Arnold, E.

Citation:

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex that Confer Multi-Nucleoside Drug Resistance
Antimicrob.Agents Chemother. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.501Å R work:0.192R free:0.224

NDB ID:

5TXM

PDB ID:

5TXM 

Release:

2017-04-05

Title:

STRUCTURE OF HIV-1 REVERSE TRANSCRIPTASE (RT) TERNARY COMPLEX WITH A DOUBLE STRANDED DNA AND AN INCOMING DDATP

Classification:

TRANSFERASE/DNA

Authors:

Das, K., Martinez, S.M., Arnold, E.

Citation:

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex that Confer Multi-Nucleoside Drug Resistance
Antimicrob.Agents Chemother. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.183R free:0.222

NDB ID:

5TXN

PDB ID:

5TXN 

Release:

2017-04-05

Title:

STRUCTURE OF Q151M MUTANT HIV-1 REVERSE TRANSCRIPTASE (RT) TERNARY COMPLEX WITH A DOUBLE STRANDED DNA AND AN INCOMING DATP

Classification:

TRANSFERASE/DNA

Authors:

Das, K., Martinez, S.M., Arnold, E.

Citation:

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex that Confer Multi-Nucleoside Drug Resistance
Antimicrob.Agents Chemother. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.55Å R work:0.195R free:0.225

NDB ID:

5TXO

PDB ID:

5TXO 

Release:

2017-04-05

Title:

STRUCTURE OF Q151M complex (A62V, V75I, F77L, F116Y, Q151M) mutant HIV-1 REVERSE TRANSCRIPTASE (RT) TERNARY COMPLEX WITH A DOUBLE STRANDED DNA AND AN INCOMING DATP

Classification:

TRANSFERASE/DNA

Authors:

Das, K., Martinez, S.M., Arnold, E.

Citation:

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex that Confer Multi-Nucleoside Drug Resistance
Antimicrob.Agents Chemother. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.546Å R work:0.19R free:0.227

NDB ID:

5TXP

PDB ID:

5TXP 

Release:

2017-04-05

Title:

STRUCTURE OF Q151M complex (A62V, V75I, F77L, F116Y, Q151M) mutant HIV-1 REVERSE TRANSCRIPTASE (RT) TERNARY COMPLEX WITH A DOUBLE STRANDED DNA AND AN INCOMING DDATP

Classification:

TRANSFERASE/DNA

Authors:

Das, K., Martinez, S.M., Arnold, E.

Citation:

Structural Insights into HIV Reverse Transcriptase Mutations Q151M and Q151M Complex that Confer Multi-Nucleoside Drug Resistance
Antimicrob.Agents Chemother. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.196R free:0.238

NDB ID:

5UZD

PDB ID:

5UZD 

Release:

2017-04-05

Title:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure

Classification:

DNA

Authors:

Sathyamoorthy, B., Shi, H., Zhou, H., Xue, Y., Rangadurai, A., Merriman, D.K., Al-Hashimi, H.M.

Citation:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A
Nucleic Acids Res. pp. - 2017

Experiment:

SOLUTION NMR

NDB ID:

5UZF

PDB ID:

5UZF 

Release:

2017-04-05

Title:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure

Classification:

DNA

Authors:

Sathyamoorthy, B., Shi, H., Zhou, H., Xue, Y., Rangadurai, A., Merriman, D.K., Al-Hashimi, H.M.

Citation:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A
Nucleic Acids Res. pp. - 2017

Experiment:

SOLUTION NMR

NDB ID:

5UZI

PDB ID:

5UZI 

Release:

2017-04-05

Title:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure

Classification:

DNA

Authors:

Sathyamoorthy, B., Shi, H., Zhou, H., Xue, Y., Rangadurai, A., Merriman, D.K., Al-Hashimi, H.M.

Citation:

Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A
Nucleic Acids Res. pp. - 2017

Experiment:

SOLUTION NMR

NDB ID:

5IP8

PDB ID:

5IP8 

Release:

2017-03-29

Title:

Lambda-Ru(TAP)2dppz bound to d(CCGGCTCCGG)

Classification:

DNA

Authors:

Hall, J.P., Souter, J.E., Gurung, S.P., Cardin, C.J.

Citation:

Sequence specific binding of light activated Ru-polypyridyls
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.76Å R work:0.187R free:0.219

NDB ID:

5IYE

PDB ID:

5IYE 

Release:

2017-03-29

Title:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 resolution

Classification:

DNA

Authors:

Karthik, S., Thirugnanasambandam, A., Mandal, P.K., Gautham, N.

Citation:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 angstrom resolution.
Nucleosides Nucleotides Nucleic Acids pp.1 - 12 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.694Å R work:0.188R free:0.219

NDB ID:

5IYG

PDB ID:

5IYG 

Release:

2017-03-29

Title:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 resolution

Classification:

DNA

Authors:

Karthik, S., Thirugnanasambandam, A., Mandal, P.K., Gautham, N.

Citation:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 angstrom resolution.
Nucleosides Nucleotides Nucleic Acids pp.1 - 12 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.701Å R work:0.213R free:0.25

NDB ID:

5IYJ

PDB ID:

5IYJ 

Release:

2017-03-29

Title:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 resolution

Classification:

DNA

Authors:

Karthik, S., Thirugnanasambandam, A., Mandal, P.K., Gautham, N.

Citation:

Comparison of X-ray crystal structures of a tetradecamer sequence d(CCCGGGTACCCGGG)2 at 1.7 angstrom resolution.
Nucleosides Nucleotides Nucleic Acids pp.1 - 12 2017

Experiment:

X-RAY DIFFRACTION Resolution:1.701Å R work:0.19R free:0.218

NDB ID:

5UOP

PDB ID:

5UOP 

Release:

2017-03-29

Title:

CRYSTAL STRUCTURE OF THE PROTOTYPE FOAMY VIRUS INTASOME WITH A 2- PYRIDINONE AMINAL INHIBITOR (COMPOUND 18)

Classification:

TRANSFERASE/DNA/INHIBITOR

Authors:

Schreier, J.D., Embrey, M.W., Raheem, I.T., Barbe, G., Campeau, L.C., Dubost, D., McCabe Dunn, J., Grobler, J., Hartingh, T.J., Hazuda, D.J., Klein, D., Miller, M.D., Moore, K.P., Nguyen, N., Pajkovic, N., Powell, D.A., Rada, V., Sanders, J.M., Sisko, J., Steele, T.G., Wai, J., Walji, A., Xu, M., Coleman, P.J.

Citation:

Discovery and optimization of 2-pyridinone aminal integrase strand transfer inhibitors for the treatment of HIV.
Bioorg. Med. Chem. Lett. 27 pp.2038 - 2046 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.85Å R work:0.182R free:0.202

NDB ID:

5UOQ

PDB ID:

5UOQ 

Release:

2017-03-29

Title:

CRYSTAL STRUCTURE OF THE PROTOTYPE FOAMY VIRUS INTASOME WITH A 2- PYRIDINONE AMINAL INHIBITOR (COMPOUND 31)

Classification:

TRANSFERASE/DNA/INHIBITOR

Authors:

Schreier, J.D., Embrey, M.W., Raheem, I.T., Barbe, G., Campeau, L.C., Dubost, D., McCabe Dunn, J., Grobler, J., Hartingh, T.J., Hazuda, D.J., Klein, D., Miller, M.D., Moore, K.P., Nguyen, N., Pajkovic, N., Powell, D.A., Rada, V., Sanders, J.M., Sisko, J., Steele, T.G., Wai, J., Walji, A., Xu, M., Coleman, P.J.

Citation:

Discovery and optimization of 2-pyridinone aminal integrase strand transfer inhibitors for the treatment of HIV.
Bioorg. Med. Chem. Lett. 27 pp.2038 - 2046 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.61Å R work:0.199R free:0.216

NDB ID:

5UZ2

PDB ID:

5UZ2 

Release:

2017-03-29

Title:

Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position and 8-oxoguanine at the 10th position

Classification:

DNA

Authors:

Gruber, D.R., Hoppins, J.J., Miears, H.L., Endutkin, A.V., Zharkov, D.O., Smirnov, S.L.

Citation:

Solution Structure of a DNA Dodecamer with 5-methylcytosine at the 3rd and 9th position 8-oxoguanine at the 10th position
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5X2G

PDB ID:

5X2G 

Release:

2017-03-29

Title:

Crystal structure of Campylobacter jejuni Cas9 in complex with sgRNA and target DNA (AGAAACC PAM)

Classification:

HYDROLASE/RNA/DNA

Authors:

Yamada, M., Watanabe, Y., Gootenberg, J.S., Hirano, H., Ran, F.A., Nakane, T., Ishitani, R., Zhang, F., Nishimasu, H., Nureki, O.

Citation:

Crystal Structure of the Minimal Cas9 from Campylobacter jejuni Reveals the Molecular Diversity in the CRISPR-Cas9 Systems
Mol. Cell 65 pp.1109 - 1121.e3 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.189R free:0.221

NDB ID:

5X2H

PDB ID:

5X2H 

Release:

2017-03-29

Title:

Crystal structure of Campylobacter jejuni Cas9 in complex with sgRNA and target DNA (AGAAACA PAM)

Classification:

HYDROLASE/RNA/DNA

Authors:

Yamada, M., Watanabe, Y., Gootenberg, J.S., Hirano, H., Ran, F.A., Nakane, T., Ishitani, R., Zhang, F., Nishimasu, H., Nureki, O.

Citation:

Crystal Structure of the Minimal Cas9 from Campylobacter jejuni Reveals the Molecular Diversity in the CRISPR-Cas9 Systems
Mol. Cell 65 pp.1109 - 1121.e3 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.3Å R work:0.2R free:0.231

NDB ID:

5IP3

PDB ID:

5IP3 

Release:

2017-03-22

Title:

Tomato spotted wilt tospovirus nucleocapsid protein-ssDNA complex

Classification:

Viral protein/DNA

Authors:

Komoda, K., Narita, M., Yamashita, K., Tanaka, I., Yao, M.

Citation:

Crystal structure of TSWV nucleocapsid protein
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.25R free:0.291

NDB ID:

5X6G

PDB ID:

5X6G 

Release:

2017-03-15

Title:

Crystal Structure of SMAD5-MH1/palindromic SBE DNA complex

Classification:

METAL BINDING PROTEIN/DNA

Authors:

Chai, N., Li, W.X., Wang, J., Wang, Z.X., Yang, S.M., Wu, J.W.

Citation:

Structural basis for the Smad5 MH1 domain to recognize different DNA sequences.
Nucleic Acids Res. 43 pp.9051 - 9064 2015

Experiment:

X-RAY DIFFRACTION Resolution:3.05Å R work:0.222R free:0.255

NDB ID:

5X6H

PDB ID:

5X6H 

Release:

2017-03-15

Title:

Crystal Structure of SMAD5-MH1/GC-BRE DNA complex

Classification:

METAL BINDING PROTEIN/DNA

Authors:

Chai, N., Li, W.X., Wang, J., Wang, Z.X., Yang, S.M., Wu, J.W.

Citation:

Structural basis for the Smad5 MH1 domain to recognize different DNA sequences.
Nucleic Acids Res. 43 pp.9051 - 9064 2015

Experiment:

X-RAY DIFFRACTION Resolution:3.1Å R work:0.201R free:0.231

NDB ID:

5X6M

PDB ID:

5X6M 

Release:

2017-03-15

Title:

Crystal Structure of SMAD5-MH1 in complex with a composite DNA sequence

Classification:

METAL BINDING PROTEIN/DNA

Authors:

Chai, N., Li, W.X., Wang, J., Wang, Z.X., Yang, S.M., Wu, J.W.

Citation:

Structural basis for the Smad5 MH1 domain to recognize different DNA sequences.
Nucleic Acids Res. 43 pp.9051 - 9064 2015

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.21R free:0.252

NDB ID:

5T5A

PDB ID:

5T5A 

Release:

2017-03-08

Title:

Crystal Structure of the Twister Sister (TS) Ribozyme at 2.0 Angstrom

Classification:

RNA

Authors:

Liu, Y., Wilson, T.J., Lilley, D.M.

Citation:

The structure of a nucleolytic ribozyme that employs a catalytic metal ion.
Nat. Chem. Biol. pp. - 2017

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.169R free:0.217

NDB ID:

2NBJ

PDB ID:

2NBJ 

Release:

2017-03-01

Title:

DNA-archeal MC1 protein complex structure by NMR

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Paquet, F., Loth, K., Landon, C.

Citation:

First 3D structure of an atypical protein-DNA complex
To be Published pp. - 0

Experiment:

SOLUTION NMR