A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 27-Apr-2016 number of released structures: 8140
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 5492  Download results as an excel file       Gallery view

NDB ID:

4XQQ

PDB ID:

4XQQ 

Release:

2016-04-27

Title:

Crystal structure of AgrA LytTR domain in complex with promoters

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Gopal, B., Rajasree, K.

Citation:

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Biochem Biophys Rep pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.05Å R work:0.261R free:0.305

NDB ID:

5ED4

PDB ID:

5ED4 

Release:

2016-04-27

Title:

Structure of a PhoP-DNA complex

Classification:

TRANSCRIPTION/DNA

Authors:

He, X., Wang, L., Wang, S.

Citation:

Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.
Sci Rep 6 pp.24442 - 24442 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.182R free:0.226

NDB ID:

5HR4

PDB ID:

5HR4 

Release:

2016-04-27

Title:

Structure of Type IIL restriction-modification enzyme MmeI in complex with DNA has implications for engineering of new specificities

Classification:

Hydrolase/DNA

Authors:

Callahan, S.J., Luyten, Y.A., Gupta, Y.K., Wilson, G.G., Roberts, R.J., Morgan, R.D., Aggarwal, A.K.

Citation:

Structure of Type IIL Restriction-Modification Enzyme MmeI in Complex with DNA Has Implications for Engineering New Specificities.
Plos Biol. 14 pp.e1002442 - e1002442 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.5964Å R work:0.215R free:0.241

NDB ID:

5INK

PDB ID:

5INK 

Release:

2016-04-27

Title:

Mouse Tdp2 reaction product (5'-phosphorylated DNA)-abasic/THF-Mg2+ complex

Classification:

hydrolase/dna

Authors:

Schellenberg, M.J., Perera, L., Strom, C.N., Waters, C.A., Monian, B., Appel, C.D., Vilas, C.K., Williams, J.G., Ramsden, D.A., Williams, R.S.

Citation:

Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.164R free:0.201

NDB ID:

5INL

PDB ID:

5INL 

Release:

2016-04-27

Title:

Mouse Tdp2 reaction product (5'-phosphorylated DNA)-Mg2+ complex with deoxyadenosine

Classification:

hydrolase/dna

Authors:

Schellenberg, M.J., Perera, L., Strom, C.N., Waters, C.A., Monian, B., Appel, C.D., Vilas, C.K., Williams, J.G., Ramsden, D.A., Williams, R.S.

Citation:

Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.551Å R work:0.129R free:0.168

NDB ID:

5INO

PDB ID:

5INO 

Release:

2016-04-27

Title:

Human Tdp2 reaction product (5'-phosphorylated DNA)-Mg2+ complex

Classification:

hydrolase/dna

Authors:

Schellenberg, M.J., Perera, L., Strom, C.N., Waters, C.A., Monian, B., Appel, C.D., Vilas, C.K., Williams, J.G., Ramsden, D.A., Williams, R.S.

Citation:

Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.205Å R work:0.213R free:0.263

NDB ID:

5INP

PDB ID:

5INP 

Release:

2016-04-27

Title:

Mouse Tdp2 reaction product (5'-phosphorylated DNA)-Mn2+ complex

Classification:

hydrolase/dna

Authors:

Schellenberg, M.J., Perera, L., Strom, C.N., Waters, C.A., Monian, B., Appel, C.D., Vilas, C.K., Williams, J.G., Ramsden, D.A., Williams, R.S.

Citation:

Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.947Å R work:0.142R free:0.169

NDB ID:

5INQ

PDB ID:

5INQ 

Release:

2016-04-27

Title:

Mouse Tdp2 reaction product (5'-phosphorylated DNA)-Ca2+ complex

Classification:

hydrolase/dna

Authors:

Schellenberg, M.J., Perera, L., Strom, C.N., Waters, C.A., Monian, B., Appel, C.D., Vilas, C.K., Williams, J.G., Ramsden, D.A., Williams, R.S.

Citation:

Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.848Å R work:0.157R free:0.194

NDB ID:

4ZM0

PDB ID:

4ZM0 

Release:

2016-04-20

Title:

Antitoxin Phd from phage P1 in complex with its operator DNA inverted repeat

Classification:

TRANSCRIPTION

Authors:

Garcia-Pino, A., De Gieter, S., Talavera, A., De Greve, H., Efremov, R.G., Loris, R.

Citation:

An intrinsically disordered entropic switch determines allostery in Phd/Doc regulation
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.17Å R work:0.222R free:0.246

NDB ID:

4ZM2

PDB ID:

4ZM2 

Release:

2016-04-20

Title:

Antitoxin Phd from phage P1 in complex with its operator DNA inverted repeat in a monoclinic space group

Classification:

TRANSCRIPTION

Authors:

Garcia-Pino, A., De Gieter, S., Talavera, A., De Greve, H., Efremov, R.G., Loris, R.

Citation:

An intrinsically disordered entropic switch determines allostery in Phd/Doc regulation
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.88Å R work:0.261R free:0.27

NDB ID:

5J3E

PDB ID:

5J3E 

Release:

2016-04-20

Title:

Crystal Structure of Human THYN1 protein in complex with 5-methylcytosine containing DNA

Classification:

NUCLEAR PROTEIN/DNA

Authors:

Halabelian, L., Tempel, W., Li, Y., Bountra, C., Edwards, A.M., Arrowsmith, C.H.

Citation:

Crystal Structure of Human THYN1 protein in complex with 5-methylcytosine containing DNA
To be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.6Å R work:0.208R free:0.248

NDB ID:

4Z6C

PDB ID:

4Z6C 

Release:

2016-04-13

Title:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable CTP

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.-C., Lee, S.

Citation:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable CTP
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.677Å R work:0.2R free:0.272

NDB ID:

4Z6D

PDB ID:

4Z6D 

Release:

2016-04-13

Title:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.-C., Lee, S.

Citation:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.51Å R work:0.197R free:0.269

NDB ID:

4Z6E

PDB ID:

4Z6E 

Release:

2016-04-13

Title:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP and MANGANESE

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.-C., Lee, S.

Citation:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP and MANGANESE
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.752Å R work:0.177R free:0.248

NDB ID:

4Z6F

PDB ID:

4Z6F 

Release:

2016-04-13

Title:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP and MANGANESE

Classification:

TRANSFERASE/DNA

Authors:

Koag, M.-C., Lee, S.

Citation:

Structure of human DNA polymerase beta 279NA mutant complexed with G in the template base paired with incoming non-hydrolyzable TTP and MANGANESE
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.444Å R work:0.194R free:0.248

NDB ID:

4Z7K

PDB ID:

4Z7K 

Release:

2016-04-13

Title:

Crystal structure of CRISPR RNA processing endoribonuclease Cas6b

Classification:

Hydrolase/RNA/DNA

Authors:

Li, H., Shao, Y., Richter, H., Randau, L.

Citation:

Dual binding-mediated CRISPR RNA Processing by Cas6b
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.223R free:0.278

NDB ID:

5EIX

PDB ID:

5EIX 

Release:

2016-04-13

Title:

QUINOLONE-STABILIZED CLEAVAGE COMPLEX OF TOPOISOMERASE IV FROM KLEBSIELLA PNEUMONIAE

Classification:

ISOMERASE/DNA

Authors:

Veselkov, D.A., Laponogov, I., Pan, X.-S., Selvarajah, J., Skamrova, G.B., Branstrom, A., Narasimhan, J., Prasad, J.V.N.V., Fisher, L.M., Sanderson, M.R.

Citation:

Structure of a quinolone-stabilized cleavage complex of topoisomerase IV from Klebsiella pneumoniae and comparison with a related Streptococcus pneumoniae complex.
Acta Crystallogr.,Sect.D 72 pp.488 - 496 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.35Å R work:0.224R free:0.259

NDB ID:

5EYB

PDB ID:

5EYB 

Release:

2016-04-13

Title:

X-ray Structure of Reb1-Ter Complex

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Jaiswal, R., Choudhury, M., Zaman, S., Singh, S., Santosh, V., Bastia, D., Escalante, C.R.

Citation:

Functional architecture of the Reb1-Ter complex of Schizosaccharomyces pombe.
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.7Å R work:0.209R free:0.243

NDB ID:

5HAW

PDB ID:

5HAW 

Release:

2016-04-13

Title:

structures of the NO factor SlmA bound to DNA and the cytoskeletal cell division protein FtsZ

Classification:

CELL CYCLE/DNA

Authors:

Schumacher, M.A., Zeng, W.

Citation:

structures of the NO factor SlmA bound to DNA and the cytoskeletal cell division protein FtsZ
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.89Å R work:0.192R free:0.219

NDB ID:

5HBU

PDB ID:

5HBU 

Release:

2016-04-13

Title:

Structure of the E. coli nucleoid occlusion protein SlmA bound to DNA and the C-terminal tail of the cytoskeletal cell division protein FtsZ

Classification:

CELL CYCLE/DNA

Authors:

Schumacher, M.A., Zeng, W.

Citation:

Structure of the E. coli nucleoid occlusion protein SlmA bound to DNA and the C-terminal tail of the cytoskeletal cell division protein FtsZ
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.6Å R work:0.226R free:0.269

NDB ID:

5IUD

PDB ID:

5IUD 

Release:

2016-04-13

Title:

Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer

Classification:

Transferase/DNA

Authors:

Coloma, J., Johnson, R.E., Prakash, L., Prakash, S., Aggarwal, A.K.

Citation:

Human DNA polymerase alpha in binary complex with a DNA:DNA template-primer.
Sci Rep 6 pp.23784 - 23784 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.3Å R work:0.183R free:0.228

NDB ID:

4XQJ

PDB ID:

4XQJ 

Release:

2016-04-06

Title:

Crystal structure of AgrA LytTR domain in complex with promoters

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Gopal, B., Rajasree, K.

Citation:

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Biochem Biophys Rep pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.9Å R work:0.187R free:0.224

NDB ID:

4XQN

PDB ID:

4XQN 

Release:

2016-04-06

Title:

Crystal structure of AgrA LytTR domain in complex with promoters

Classification:

DNA/DNA BINDING PROTEIN

Authors:

Gopal, B., Rajasree, K.

Citation:

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Biochem Biophys Rep pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.3Å R work:0.211R free:0.247

NDB ID:

4XXE

PDB ID:

4XXE 

Release:

2016-04-06

Title:

Structure of AgrA LytTR domain in complex with promoters

Classification:

TRANSCRIPTION/DNA

Authors:

Gopal, B., Rajasree, K.

Citation:

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Biochem Biophys Rep pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.314R free:0.355

NDB ID:

4XYQ

PDB ID:

4XYQ 

Release:

2016-04-06

Title:

Structure of AgrA LytTR domain in complex with promoters

Classification:

DNA/DNA BINDING PROTEIN

Authors:

Gopal, B., Rajasree, K.

Citation:

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Biochem Biophys Rep pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.2R free:0.237

NDB ID:

5CLV

PDB ID:

5CLV 

Release:

2016-04-06

Title:

Crystal Structure of KorA-operator DNA complex (KorA-OA)

Classification:

TRANSCRIPTION

Authors:

Rajasekar, K.V., Lovering, A.L., Dancea, F., Scott, D.J., Harris, S.A., Bingle, L.E., Roessle, M., Thomas, C.M., Hyde, E.I., White, S.A.

Citation:

Flexibility of KorA, a plasmid-encoded, global transcription regulator, in the presence and the absence of its operator.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.5Å R work:0.279R free:0.292

NDB ID:

5CM3

PDB ID:

5CM3 

Release:

2016-04-06

Title:

Crystal Structure of KorA, a plasmid-encoded, global transcription regulator

Classification:

TRANSCRIPTION

Authors:

Rajasekar, K.V., Lovering, A.L., Dancea, F., Scott, D.J., Harris, S.A., Bingle, L.E., Roessle, M., Thomas, C.M., Hyde, E.I., White, S.A.

Citation:

Flexibility of KorA, a plasmid-encoded, global transcription regulator, in the presence and the absence of its operator.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.302Å R work:0.193R free:0.233

NDB ID:

5CR2

PDB ID:

5CR2 

Release:

2016-04-06

Title:

E. coli MazF in complex with single strand DNA substrate analog

Classification:

HYDROLASE

Authors:

Zorzini, V., Mernik, A., Lah, J., Sterckx, Y.G., De Jonge, N., Garcia-Pino, A., De Greve, H., Versees, W., Loris, R.

Citation:

Substrate Recognition and Activity Regulation of the Escherichia coli mRNA Endonuclease MazF.
J.Biol.Chem. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.9Å R work:0.223R free:0.29

NDB ID:

5HRT

PDB ID:

5HRT 

Release:

2016-04-06

Title:

Crystal structure of mouse autotaxin in complex with a DNA aptamer

Classification:

HYDROLASE

Authors:

Kato, K., Ikeda, H., Miyakawa, S., Futakawa, S., Nonaka, Y., Fujiwara, M., Okudaira, S., Kano, K., Aoki, J., Morita, J., Ishitani, R., Nishimasu, H., Nakamura, Y., Nureki, O.

Citation:

Structural basis for specific inhibition of Autotaxin by a DNA aptamer
Nat.Struct.Mol.Biol. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.997Å R work:0.163R free:0.201

NDB ID:

4Z1Z

PDB ID:

4Z1Z 

Release:

2016-03-30

Title:

Crystal Structure of Meganuclease I-SmaMI Bound to Uncleaveable DNA with a TTCT Central Four

Classification:

hydrolase/dna

Authors:

Lambert, A.R., Hallinan, J.P., Shen, B.W., Chik, J.K., Bolduc, J.M., Kulshina, N., Robins, L.I., Kaiser, B.K., Jarjour, J., Havens, K., Scharenberg, A.M., Stoddard, B.L.

Citation:

Indirect DNA sequence recognition and its impact on nuclease cleavage activity
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.237R free:0.286

NDB ID:

4Z20

PDB ID:

4Z20 

Release:

2016-03-30

Title:

Crystal Structure of Meganuclease I-SmaMI Bound to Uncleaveable DNA with a TTGT Central Four

Classification:

hydrolase/dna

Authors:

Lambert, A.R., Hallinan, J.P., Shen, B.W., Chik, J.K., Bolduc, J.M., Kulshina, N., Robins, L.I., Kaiser, B.K., Jarjour, J., Havens, K., Scharenberg, A.M., Stoddard, B.L.

Citation:

Indirect DNA sequence recognition and its impact on nuclease cleavage activity
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.233R free:0.291

NDB ID:

5CIY

PDB ID:

5CIY 

Release:

2016-03-30

Title:

Structural basis of the recognition of H3K36me3 by DNMT3B PWWP domain

Classification:

TRANSFERASE/DNA

Authors:

Rondelet, G., Dal Maso, T., Willems, L., Wouters, J.

Citation:

Structural basis for recognition of histone H3K36me3 nucleosome by human de novo DNA methyltransferases 3A and 3B.
J.Struct.Biol. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.594Å R work:0.165R free:0.188

NDB ID:

5ESP

PDB ID:

5ESP 

Release:

2016-03-30

Title:

Crystal Structure of LAGLIDADG Meganuclease I-PanMI with coordinated Calcium ions

Classification:

HYDROLASE/DNA

Authors:

Lambert, A.R., Hallinan, J.P., Shen, B.W., Chik, J.K., Bolduc, J.M., Kulshina, N., Robins, L.I., Kaiser, B.K., Jarjour, J., Havens, K., Scharenberg, A.M., Stoddard, B.L.

Citation:

Indirect DNA sequence recognition and its impact on nuclease cleavage activity
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.995Å R work:0.225R free:0.269

NDB ID:

5FFJ

PDB ID:

5FFJ 

Release:

2016-03-30

Title:

Structure of a nuclease-deletion mutant of the Type ISP restriction-modification enzyme LlaGI in complex with a DNA substrate mimic

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Kulkarni, M., Nirwan, N., van Aelst, K., Szczelkun, M.D., Saikrishnan, K.

Citation:

Structural insights into DNA sequence recognition by Type ISP restriction-modification enzymes
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.84Å R work:0.229R free:0.262

NDB ID:

5FHD

PDB ID:

5FHD 

Release:

2016-03-30

Title:

Structure of Bacteroides sp Pif1 complexed with tailed dsDNA resulting in ssDNA bound complex

Classification:

HYDROLASE/DNA

Authors:

Zhou, X., Ren, W., Bharath, S.R., Tang, X., He, Y., Chen, C., Liu, Z., Li, D., Song, H.

Citation:

Structural and Functional Insights into the Unwinding Mechanism of Bacteroides sp Pif1
Cell Rep 14 pp.2030 - 2039 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.0Å R work:0.178R free:0.211

NDB ID:

5FHE

PDB ID:

5FHE 

Release:

2016-03-30

Title:

Crystal structure of Bacteroides Pif1 bound to ssDNA

Classification:

HYDROLASE/DNA

Authors:

Zhou, X., Ren, W., Bharath, S.R., Tang, X., He, Y., Chen, C., Liu, Z., Li, D., Song, H.

Citation:

Structural and Functional Insights into the Unwinding Mechanism of Bacteroides sp Pif1
Cell Rep 14 pp.2030 - 2039 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.9Å R work:0.222R free:0.277

NDB ID:

5IPL

PDB ID:

5IPL 

Release:

2016-03-30

Title:

SigmaS-transcription initiation complex with 4-nt nascent RNA

Classification:

TRANSCRIPTION, TRANSFERASE/DNA/RNA

Authors:

Liu, B., Zuo, Y., Steitz, T.A.

Citation:

Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.6Å R work:0.247R free:0.293

NDB ID:

5IPM

PDB ID:

5IPM 

Release:

2016-03-30

Title:

SigmaS-transcription initiation complex with 4-nt nascent RNA

Classification:

TRANSCRIPTION, TRANSFERASE/DNA/RNA

Authors:

Liu, B., Zuo, Y., Steitz, T.A.

Citation:

Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:4.2Å R work:0.27R free:0.33

NDB ID:

5IPN

PDB ID:

5IPN 

Release:

2016-03-30

Title:

SigmaS-transcription initiation complex with 4-nt nascent RNA

Classification:

TRANSCRIPTION, TRANSFERASE/DNA/RNA

Authors:

Liu, B., Zuo, Y., Steitz, T.A.

Citation:

Structures of E. coli sigma S-transcription initiation complexes provide new insights into polymerase mechanism.
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:4.61Å R work:0.279R free:0.344

NDB ID:

4YIS

PDB ID:

4YIS 

Release:

2016-03-23

Title:

Crystal Structure of LAGLIDADG Meganuclease I-CpaMI Bound to Uncleaved DNA

Classification:

hydrolase/dna

Authors:

Lambert, A.R., Hallinan, J.P., Shen, B.W., Chik, J.K., Bolduc, J.M., Kulshina, N., Robins, L.I., Kaiser, B.K., Jarjour, J., Havens, K., Scharenberg, A.M., Stoddard, B.L.

Citation:

Indirect DNA sequence recognition and its impact on nuclease cleavage activity
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.89Å R work:0.217R free:0.273

NDB ID:

4YIT

PDB ID:

4YIT 

Release:

2016-03-23

Title:

Crystal Structure of LAGLIDADG Meganuclease I-AabMI Bound to Uncleaved DNA

Classification:

hydrolase/dna

Authors:

Lambert, A.R., Hallinan, J.P., Shen, B.W., Chik, J.K., Bolduc, J.M., Kulshina, N., Robins, L.I., Kaiser, B.K., Jarjour, J., Havens, K., Scharenberg, A.M., Stoddard, B.L.

Citation:

Indirect DNA sequence recognition and its impact on nuclease cleavage activity
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.24Å R work:0.225R free:0.298

NDB ID:

4YMC

PDB ID:

4YMC 

Release:

2016-03-23

Title:

Lambda-[Ru(TAP)2(dppz)]2+ bound to d(CCGGATCCGG)2

Classification:

DNA

Authors:

Keane, P.M., Gurung, S.P., Niyazi, H., Poynton, F.E., Hall, J.P., Sazanovich, I.V., Towrie, M., Teixeira, S., Mitchell, E., Forsyth, T., Gunnlaugsson, T., Quinn, S.J., Cardin, C.J., Kelly, J.M.

Citation:

Reversal of a single base pair step controls guanine photo-oxidation by an intercalating Ru(II) dipyridophenazine complex.
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.88Å R work:0.197R free:0.257

NDB ID:

5D23

PDB ID:

5D23 

Release:

2016-03-23

Title:

The crystal structure of STPR from Bombyx mori in complex with 13-bp DNA derived from the +290 site of fibroin gene

Classification:

TRANSCRIPTION/DNA

Authors:

Yu, L.Y., Cheng, W., Zhou, K., Li, W.F., Yu, H.M., Gao, X., Shen, X., Wu, Q., Chen, Y., Zhou, C.Z.

Citation:

Structures of an all-alpha protein running along the DNA major groove.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.95Å R work:0.204R free:0.231

NDB ID:

5D2Q

PDB ID:

5D2Q 

Release:

2016-03-23

Title:

Crystal structure of STPR from Bombyx Mori in complex with 20-bp DNA derived from +290 site of the fibroin gene

Classification:

TRANSCRIPTION/DNA

Authors:

Yu, L.Y., Cheng, W., Zhou, K., Li, W.F., Yu, H.M., Gao, X., Shen, X., Wu, Q., Chen, Y., Zhou, C.Z.

Citation:

Structures of an all-alpha protein running along the DNA major groove.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.4Å R work:0.246R free:0.295

NDB ID:

5D2S

PDB ID:

5D2S 

Release:

2016-03-23

Title:

Crystal structure of STPR from Bombyx mori in complex with 18-bp DNA containing four repetitive units of ATAC

Classification:

TRANSCRIPTION/DNA

Authors:

Yu, L.Y., Cheng, W., Zhou, K., Li, W.F., Yu, H.M., Gao, X., Shen, X., Wu, Q., Chen, Y., Zhou, C.Z.

Citation:

Structures of an all-alpha protein running along the DNA major groove.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.226R free:0.253

NDB ID:

5E3L

PDB ID:

5E3L 

Release:

2016-03-23

Title:

Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Hancock, S.P., Stella, S., Cascio, D., Johnson, R.C.

Citation:

DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One 11 pp.e0150189 - e0150189 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.66Å R work:0.209R free:0.248

NDB ID:

5F0Q

PDB ID:

5F0Q 

Release:

2016-03-23

Title:

Crystal structure of C-terminal domain of the human DNA primase large subunit with bound DNA template/RNA primer

Classification:

Tranferase/DNA/RNA

Authors:

Baranovskiy, A.G., Babayeva, N.D., Zhang, Y., Gu, J., Suwa, Y., Pavlov, Y.I., Tahirov, T.H.

Citation:

MECHANISM OF CONCERTED RNA-DNA PRIMER SYNTHESIS BY THE HUMAN PRIMOSOME.
J.Biol.Chem. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.21Å R work:0.223R free:0.257

NDB ID:

5F0S

PDB ID:

5F0S 

Release:

2016-03-23

Title:

Crystal structure of C-terminal domain of the human DNA primase large subunit with bound DNA template/RNA primer and manganese ion

Classification:

Replication/DNA/RNA

Authors:

Baranovskiy, A.G., Babayeva, N.D., Zhang, Y., Gu, J., Suwa, Y., Pavlov, Y.I., Tahirov, T.H.

Citation:

MECHANISM OF CONCERTED RNA-DNA PRIMER SYNTHESIS BY THE HUMAN PRIMOSOME.
J.Biol.Chem. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.0Å R work:0.231R free:0.268

NDB ID:

5HQ2

PDB ID:

5HQ2 

Release:

2016-03-23

Title:

Structural model of Set8 histone H4 Lys20 methyltransferase bound to nucleosome core particle

Classification:

Transferase/DNA

Authors:

Girish, T.S., McGinty, R.K., Tan, S.

Citation:

Multivalent Interactions by the Set8 Histone Methyltransferase With Its Nucleosome Substrate.
J.Mol.Biol. 428 pp.1531 - 1543 2016

Experiment:

X-RAY DIFFRACTION Resolution:4.5Å R work:0.339R free:0.397

NDB ID:

NA3391

PDB ID:

5FQ5 

Release:

2016-03-23

Title:

Crystal structure of Cas9-sgRNA-DNA complex solved by native SAD phasing

Classification:

HYDROLASE/DNA

Authors:

Olieric, V., Weinert, T., Finke, A.D., Anders, C., Li, D., Olieric, N., Borca, C.N., Steinmetz, M.O., Caffrey, M., Jinek, M., Wang, M.

Citation:

Data-Collection Strategy for Challenging Native Sad Phasing.
Acta Crystallogr.,Sect.D 72 pp.421 - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.136Å R work:0.19R free:0.224