A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 17-Aug-2016 number of released structures: 8433
Search for released structures

DNA Search Options:

Polymer

All
DNA Only
Protein DNA Complexes
Drug DNA Complexes
Hybrids and Chimera
Peptide Nucleic Acid / Mimetics

Protein Function

All
Enzymes
Structural
Regulatory
Other

Structural Features

All
Single Stranded
A DNA
B DNA
Z DNA
Other Double
       Helical Structures
Triple helices
Quadruple helices

Experimental Method

All
XRAY
NMR

Text Search

Filter results by text search

Use this option to narrow your results down considerably (>50% reduction) using any word seen in the results page. Eg: Any author name found in the right side



Polymer Type: All + Protein Function: All + Structural Features: All + Experimental Method: All

Results: 5682  Download results as an excel file       Gallery view

NDB ID:

5KGV

PDB ID:

5KGV 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KI4

PDB ID:

5KI4 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KI5

PDB ID:

5KI5 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KI7

PDB ID:

5KI7 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KIB

PDB ID:

5KIB 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KIE

PDB ID:

5KIE 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KIF

PDB ID:

5KIF 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

5KIH

PDB ID:

5KIH 

Release:

2016-08-24

Title:

Structural impact of single ribonucleotides in DNA

Classification:

DNA

Authors:

Evich, M., Spring-Connell, A.M., Storici, F., Germann, M.W.

Citation:

Structural impact of single ribonucleotides in DNA.
Chembiochem pp. - 2016

Experiment:

SOLUTION NMR

NDB ID:

2N89

PDB ID:

2N89 

Release:

2016-08-17

Title:

Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC at acidic pH

Classification:

DNA

Authors:

Assi, H.A., Harkness, R.W., Martin-Pintado, N., Wilds, C.J., Campos-Olivas, R., Mittermaier, A.K., Gonzalez, C., Damha, M.J.

Citation:

Stabilization of i-motif structures by 2'-beta-fluorination of DNA.
Nucleic Acids Res. 44 pp.4998 - 5009 2016

Experiment:

SOLUTION NMR

NDB ID:

5BT2

PDB ID:

5BT2 

Release:

2016-08-17

Title:

MeCP2 MBD domain (A140V) in complex with methylated DNA

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Chia, J.Y., Tan, W.S., Ng, C.L., Hu, N.J., Foo, H.L., Ho, K.L.

Citation:

A/T Run Geometry of B-form DNA Is Independent of Bound Methyl-CpG Binding Domain, Cytosine Methylation and Flanking Sequence
Sci Rep 6 pp.31210 - 31210 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.174R free:0.226

NDB ID:

5D8F

PDB ID:

5D8F 

Release:

2016-08-17

Title:

crystal structure of SSB and ssDNA complex from homo sapiens

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Li, Y.H., Gao, Z.Q., Dong, Y.H.

Citation:

crystal structure of SSB and ssDNA complex from homo sapiens
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.238R free:0.281

NDB ID:

5HLT

PDB ID:

5HLT 

Release:

2016-08-17

Title:

Crystal structure of pyrene- and phenanthrene-modified DNA in complex with the BpuJ1 endonuclease binding domain

Classification:

HYDROLASE

Authors:

Probst, M., Aeschimann, W., Chau, T.T., Langenegger, S.M., Stocker, A., Haner, R.

Citation:

Structural insight into DNA-assembled oligochromophores: crystallographic analysis of pyrene- and phenanthrene-modified DNA in complex with BpuJI endonuclease.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.672Å R work:0.2R free:0.243

NDB ID:

5HNF

PDB ID:

5HNF 

Release:

2016-08-17

Title:

Crystal structure of pyrene- and phenanthrene-modified DNA in complex with the BpuJ1 endonuclease binding domain

Classification:

HYDROLASE

Authors:

Probst, M., Aeschimann, W., Chau, T.T., Langenegger, S.M., Stocker, A., Haner, R.

Citation:

Structural insight into DNA-assembled oligochromophores: crystallographic analysis of pyrene- and phenanthrene-modified DNA in complex with BpuJI endonuclease.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.546Å R work:0.17R free:0.195

NDB ID:

5HNH

PDB ID:

5HNH 

Release:

2016-08-17

Title:

Crystal structure of pyrene- and phenanthrene-modified DNA in complex with the BpuJ1 endonuclease binding domain

Classification:

HYDROLASE

Authors:

Probst, M., Aeschimann, W., Chau, T.T., Langenegger, S.M., Stocker, A., Haner, R.

Citation:

Structural insight into DNA-assembled oligochromophores: crystallographic analysis of pyrene- and phenanthrene-modified DNA in complex with BpuJI endonuclease.
Nucleic Acids Res. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.876Å R work:0.169R free:0.199

NDB ID:

5III

PDB ID:

5III 

Release:

2016-08-17

Title:

Crystal structure of the pre-catalytic ternary complex of DNA polymerase lambda with a templating 8-oxo-dG and an incoming dATP

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.8Å R work:0.2R free:0.225

NDB ID:

5IIJ

PDB ID:

5IIJ 

Release:

2016-08-17

Title:

Crystal structure of the pre-catalytic ternary complex of DNA polymerase lambda with a templating 8-oxo-dG and an incoming dCTP

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.724Å R work:0.196R free:0.224

NDB ID:

5IIK

PDB ID:

5IIK 

Release:

2016-08-17

Title:

Crystal structure of the post-catalytic nick complex of DNA polymerase lambda with a templating 8-oxo-dG and incorporated dC

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.982Å R work:0.191R free:0.237

NDB ID:

5IIL

PDB ID:

5IIL 

Release:

2016-08-17

Title:

Crystal structure of the post-catalytic nick complex of DNA polymerase lambda with a templating 8-oxo-dG and incorporated dA

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.96Å R work:0.179R free:0.217

NDB ID:

5IIN

PDB ID:

5IIN 

Release:

2016-08-17

Title:

Crystal structure of the pre-catalytic ternary extension complex of DNA polymerase lambda with an 8-oxo-dG:dC base-pair

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.15Å R work:0.187R free:0.231

NDB ID:

5IIO

PDB ID:

5IIO 

Release:

2016-08-17

Title:

Crystal structure of the DNA polymerase lambda binary complex

Classification:

TRANSFERASE/DNA

Authors:

Burak, M.J., Guja, K.E., Hambardjieva, E., Derkunt, B., Garcia-Diaz, M.

Citation:

A fidelity mechanism in DNA polymerase lambda promotes error-free bypass of 8-oxo-dG.
Embo J. pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.08Å R work:0.191R free:0.235

NDB ID:

5CHI

PDB ID:

5CHI 

Release:

2016-08-10

Title:

Crystal structure of PF2046 in complex with ssDNA

Classification:

HYDROLASE/DNA

Authors:

Kim, J.S., Sambalkhundev, G.D., Kim, S.H., Han, A., Ko, S.M., Hwang, K.Y., Lee, W.C.

Citation:

Structural basis of two-nucleotide removal of ssDNA by a cryptic RNase H fold 3'-5' exonuclease PF2046 from Pyrococcus furiosus
to be published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:2.472Å R work:0.182R free:0.227

NDB ID:

5D39

PDB ID:

5D39 

Release:

2016-08-10

Title:

Transcription factor-DNA complex

Classification:

TRANSCRIPTION/DNA

Authors:

Li, J., Niu, F., Pu, M., Ouyang, S., Liu, Z.

Citation:

Transcription factor-DNA complex
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:3.2Å R work:0.21R free:0.236

NDB ID:

5DLF

PDB ID:

5DLF 

Release:

2016-08-10

Title:

Crystal Structure of Human DNA Polymerase Eta Inserting dATP Opposite O4-Methylhymidine

Classification:

Transferase/DNA

Authors:

OFlaherty, D.K., Patra, A., Egli, M., Wilds, C.J.

Citation:

Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase Eta
Chem Sci 7 pp.4896 - 4904 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.97Å R work:0.163R free:0.217

NDB ID:

5DLG

PDB ID:

5DLG 

Release:

2016-08-10

Title:

Crystal Structure of Human DNA Polymerase Eta Inserting dGMPNPP Opposite O4-Methylhymidine

Classification:

Transferase/DNA

Authors:

OFlaherty, D.K., Patra, A., Egli, M., Wilds, C.J.

Citation:

Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase Eta
Chem Sci 7 pp.4896 - 4904 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.351Å R work:0.171R free:0.247

NDB ID:

5DQG

PDB ID:

5DQG 

Release:

2016-08-10

Title:

Crystal Structure of Human DNA Polymerase Eta Inserting dAMPNPP Opposite O4-Ethylthymidine

Classification:

Transferase/DNA

Authors:

OFlaherty, D.K., Patra, A., Egli, M., Wilds, C.J.

Citation:

Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase Eta
Chem Sci 7 pp.4896 - 4904 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.29Å R work:0.175R free:0.226

NDB ID:

5DQH

PDB ID:

5DQH 

Release:

2016-08-10

Title:

Crystal Structure of Human DNA Polymerase Eta Inserting dGMPNPP Opposite O4-Ethylthymidine

Classification:

Transferase/DNA

Authors:

OFlaherty, D.K., Patra, A., Egli, M., Wilds, C.J.

Citation:

Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase Eta
Chem Sci 7 pp.4896 - 4904 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.99Å R work:0.161R free:0.21

NDB ID:

5DQI

PDB ID:

5DQI 

Release:

2016-08-10

Title:

Crystal Structure of Human DNA Polymerase Eta Extending an O4-Ethylthymidine : dA Pair By Inserting dCTP Opposite dG

Classification:

Transferase/DNA

Authors:

OFlaherty, D.K., Patra, A., Egli, M., Wilds, C.J.

Citation:

Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase Eta
Chem Sci 7 pp.4896 - 4904 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.3Å R work:0.203R free:0.265

NDB ID:

5K83

PDB ID:

5K83 

Release:

2016-08-10

Title:

Crystal Structure of a Primate APOBEC3G N-Domain, in Complex with ssDNA

Classification:

HYDROLASE

Authors:

Xiao, X., Li, S.X., Yang, H., Chen, X.S.

Citation:

Crystal structures of APOBEC3G N-domain alone and its complex with DNA.
Nat Commun 7 pp.12193 - 12193 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.39Å R work:0.186R free:0.25

NDB ID:

5KEK

PDB ID:

5KEK 

Release:

2016-08-10

Title:

Structure Determination of a Self-Assembling DNA Crystal

Classification:

DNA

Authors:

Simmons, C.R., Zhang, F., Birktoft, J.J., Qi, X., Han, D., Liu, Y., Sha, R., Abdallah, H.O., Hernandez, C., Ohayon, Y.P., Seeman, N.C., Yan, H.

Citation:

Construction and Structure Determination of a Three-Dimensional DNA Crystal.
J.Am.Chem.Soc. 138 pp.10047 - 10054 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.098Å R work:0.204R free:0.259

NDB ID:

5KEO

PDB ID:

5KEO 

Release:

2016-08-10

Title:

Structure Determination of a Self-Assembling DNA Crystal

Classification:

DNA

Authors:

Simmons, C.R., Zhang, F., Birktoft, J.J., Qi, X., Han, D., Liu, Y., Sha, R., Abdallah, H.O., Hernandez, C., Ohayon, Y.P., Seeman, N.C., Yan, H.

Citation:

Construction and Structure Determination of a Three-Dimensional DNA Crystal.
J.Am.Chem.Soc. 138 pp.10047 - 10054 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.15Å R work:0.231R free:0.275

NDB ID:

5KK5

PDB ID:

5KK5 

Release:

2016-08-10

Title:

AsCpf1(E993A)-crRNA-DNA ternary complex

Classification:

Hydrolase/DNA/RNA

Authors:

Gao, P., Yang, H., Rajashankar, K.R., Huang, Z., Patel, D.J.

Citation:

Type V CRISPR-Cas Cpf1 endonuclease employs a unique mechanism for crRNA-mediated target DNA recognition.
Cell Res. 26 pp.901 - 913 2016

Experiment:

X-RAY DIFFRACTION Resolution:3.289Å R work:0.216R free:0.254

NDB ID:

5B31

PDB ID:

5B31 

Release:

2016-08-03

Title:

The crystal structure of the heterotypic H2AZ/H2A nucleosome with H3.1.

Classification:

DNA BINDING PROTEIN

Authors:

Horikoshi, N., Arimura, Y., Taguchi, H., Kurumizaka, H.

Citation:

Crystal structures of heterotypic nucleosomes containing histones H2A.Z and H2A.
Open Biology 6 pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.2Å R work:0.225R free:0.27

NDB ID:

5B32

PDB ID:

5B32 

Release:

2016-08-03

Title:

The crystal structure of the heterotypic H2AZ/H2A nucleosome with H3.3.

Classification:

DNA BINDING PROTEIN

Authors:

Horikoshi, N., Arimura, Y., Taguchi, H., Kurumizaka, H.

Citation:

Crystal structures of heterotypic nucleosomes containing histones H2A.Z and H2A.
Open Biology 6 pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.35Å R work:0.226R free:0.259

NDB ID:

5B33

PDB ID:

5B33 

Release:

2016-08-03

Title:

The crystal structure of the H2AZ nucleosome with H3.3.

Classification:

DNA BINDING PROTEIN

Authors:

Horikoshi, N., Arimura, Y., Taguchi, H., Kurumizaka, H.

Citation:

Crystal structures of heterotypic nucleosomes containing histones H2A.Z and H2A.
Open Biology 6 pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.925Å R work:0.205R free:0.252

NDB ID:

5FD3

PDB ID:

5FD3 

Release:

2016-08-03

Title:

Structure of Lin54 tesmin domain bound to DNA

Classification:

TRANSCRIPTION/DNA

Authors:

Marceau, A.H., Felthousen, J.G., Goetsch, P.D., Iness, A.N., Lee, H.W., Tripathi, S.M., Strome, S., Litovchick, L., Rubin, S.M.

Citation:

Structural basis for LIN54 recognition of CHR elements in cell cycle-regulated promoters.
Nat Commun 7 pp.12301 - 12301 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.42Å R work:0.18R free:0.238

NDB ID:

5IZP

PDB ID:

5IZP 

Release:

2016-08-03

Title:

Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position

Classification:

DNA

Authors:

Gruber, D.R., Hoppins, J.J., Miears, H.L., Kiryutin, A.S., Kasymov, R.D., Yurkovskaya, A.V., Zharkov, D.O., Smirnov, S.L.

Citation:

Structure of 8-oxoguanine in the EcoRI recognition site and loss of EcoRI function/recognition.
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5J2M

PDB ID:

5J2M 

Release:

2016-08-03

Title:

HIV-1 reverse transcriptase in complex with DNA and EFdA-triphosphate, a translocation-defective RT inhibitor

Classification:

transferase/dna

Authors:

Salie, Z.L., Kirby, K.A., Michailidis, E., Marchand, B., Singh, K., Rohan, L.C., Kodama, E.N., Mitsuya, H., Parniak, M.A., Sarafianos, S.G.

Citation:

Structural basis of HIV inhibition by translocation-defective RT inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA).
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.432Å R work:0.199R free:0.232

NDB ID:

5J2N

PDB ID:

5J2N 

Release:

2016-08-03

Title:

HIV-1 reverse transcriptase in complex with DNA that has incorporated EFdA-MP at the P-(post-translocation) site and dTMP at the N-(pre-translocation) site

Classification:

transferase/dna

Authors:

Salie, Z.L., Kirby, K.A., Michailidis, E., Marchand, B., Singh, K., Rohan, L.C., Kodama, E.N., Mitsuya, H., Parniak, M.A., Sarafianos, S.G.

Citation:

Structural basis of HIV inhibition by translocation-defective RT inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA).
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.896Å R work:0.211R free:0.241

NDB ID:

5J2P

PDB ID:

5J2P 

Release:

2016-08-03

Title:

HIV-1 reverse transcriptase in complex with DNA that has incorporated EFdA-MP at the P-(post-translocation) site and a second EFdA-MP at the N-(pre-translocation) site

Classification:

transferase/dna

Authors:

Salie, Z.L., Kirby, K.A., Michailidis, E., Marchand, B., Singh, K., Rohan, L.C., Kodama, E.N., Mitsuya, H., Parniak, M.A., Sarafianos, S.G.

Citation:

Structural basis of HIV inhibition by translocation-defective RT inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA).
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.53Å R work:0.193R free:0.246

NDB ID:

5J2Q

PDB ID:

5J2Q 

Release:

2016-08-03

Title:

HIV-1 reverse transcriptase in complex with DNA that has incorporated a mismatched EFdA-MP at the N-(pre-translocation) site

Classification:

transferase/dna

Authors:

Salie, Z.L., Kirby, K.A., Michailidis, E., Marchand, B., Singh, K., Rohan, L.C., Kodama, E.N., Mitsuya, H., Parniak, M.A., Sarafianos, S.G.

Citation:

Structural basis of HIV inhibition by translocation-defective RT inhibitor 4'-ethynyl-2-fluoro-2'-deoxyadenosine (EFdA).
Proc.Natl.Acad.Sci.USA pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.789Å R work:0.211R free:0.252

NDB ID:

5D46

PDB ID:

5D46 

Release:

2016-07-27

Title:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination

Classification:

TRANSFERASE

Authors:

Loc'h, J., Rosario, S., Delarue, M.

Citation:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination.
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.8Å R work:0.197R free:0.245

NDB ID:

5D49

PDB ID:

5D49 

Release:

2016-07-27

Title:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination

Classification:

TRANSFERASE

Authors:

Loc'h, J., Rosario, S., Delarue, M.

Citation:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination.
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.99Å R work:0.197R free:0.244

NDB ID:

5D4B

PDB ID:

5D4B 

Release:

2016-07-27

Title:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination

Classification:

TRANSFERASE

Authors:

Loc'h, J., Rosario, S., Delarue, M.

Citation:

Structural Basis for a New Templated Activity by Terminal Deoxynucleotidyl Transferase: Implications for V(D)J Recombination.
Structure pp. - 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.66Å R work:0.207R free:0.247

NDB ID:

5DS9

PDB ID:

5DS9 

Release:

2016-07-27

Title:

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Classification:

DNA BINDING PROTEIN/DNA

Authors:

Hancock, S.P., Stella, S., Cascio, D., Johnson, R.C.

Citation:

DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One 11 pp.e0150189 - e0150189 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.561Å R work:0.222R free:0.251

NDB ID:

5IV1

PDB ID:

5IV1 

Release:

2016-07-27

Title:

Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position

Classification:

DNA

Authors:

Miears, H.L., Gruber, D.R., Hoppins, J.J., Kiryutin, A.S., Kasymov, R.D., Yurkovskaya, A.V., Zharkov, D.O., Smirnov, S.L.

Citation:

Structure of 8-oxoguanine in the EcoRI recognition site and loss of EcoRI function/recognition.
To Be Published pp. - 0

Experiment:

SOLUTION NMR

NDB ID:

5LGY

PDB ID:

5LGY 

Release:

2016-07-27

Title:

Lysine 120-acetylated P53 DNA binding domain in a complex with the BAX response element.

Classification:

TRANSCRIPTION

Authors:

Vainer, R., Cohen, S., Shahar, A., Zarivach, R., Arbely, E.

Citation:

Structural Basis for p53 Lys120-Acetylation-Dependent DNA-Binding Mode.
J.Mol.Biol. 428 pp.3013 - 3025 2016

Experiment:

X-RAY DIFFRACTION Resolution:2.92Å R work:0.237R free:0.277

NDB ID:

5AXE

PDB ID:

5AXE 

Release:

2016-07-20

Title:

Crystal Structure Analysis of DNA Duplexes containing sulfoamide-bridged nucleic acid (SuNA-NH)

Classification:

DNA

Authors:

Mitsuoka, Y., Aoyama, H., Kugimiya, A., Fujimura, Y., Yamamoto, T., Waki, R., Wada, F., Tahara, S., Sawamura, M., Noda, M., Hari, Y., Obika, S.

Citation:

Effect of an N-substituent in sulfonamide-bridged nucleic acid (SuNA) on hybridization ability and duplex structure.
Org.Biomol.Chem. 14 pp.6531 - 6538 2016

Experiment:

X-RAY DIFFRACTION Resolution:0.95Å R work:0.125R free:0.143

NDB ID:

5AXF

PDB ID:

5AXF 

Release:

2016-07-20

Title:

Crystal Structure Analysis of DNA Duplexes containing sulfoamide-bridged nucleic acid (SuNA-NMe)

Classification:

DNA

Authors:

Mitsuoka, Y., Aoyama, H., Kugimiya, A., Fujimura, Y., Yamamoto, T., Waki, R., Wada, F., Tahara, S., Sawamura, M., Noda, M., Hari, Y., Obika, S.

Citation:

Effect of an N-substituent in sulfonamide-bridged nucleic acid (SuNA) on hybridization ability and duplex structure.
Org.Biomol.Chem. 14 pp.6531 - 6538 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.13Å R work:0.13R free:0.144

NDB ID:

5CDB

PDB ID:

5CDB 

Release:

2016-07-20

Title:

Structure of the complex of a bimolecular human telomeric DNA with a 13-diphenylalkyl Berberine derivative

Classification:

DNA

Authors:

Ferraroni, M., Bazzicalupi, C., Papi, F., Fiorillo, G., Guaman-Ortiz, L.M., Nocentini, A., Scovassi, A.I., Lombardi, P., Gratteri, P.

Citation:

Solution and Solid-State Analysis of Binding of 13-Substituted Berberine Analogues to Human Telomeric G-quadruplexes.
Chem Asian J 11 pp.1107 - 1115 2016

Experiment:

X-RAY DIFFRACTION Resolution:1.7Å R work:0.231R free:0.284

NDB ID:

5CHZ

PDB ID:

5CHZ 

Release:

2016-07-20

Title:

Structure of wild-type human MBD4 bound to a G:T mismatch

Classification:

HYDROLASE/DNA

Authors:

Ouzon-Shubeita, H., Lin, Y.-L., Lee, S.

Citation:

Structure of wild-type human MBD4 bound to a G:T mismatch
To Be Published pp. - 0

Experiment:

X-RAY DIFFRACTION Resolution:1.83Å R work:0.173R free:0.208