A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 22-Jun-2016 number of released structures: 8305
Search for released structures

NDB ID: 1QWB    PDB ID: 1QWB 


Title:

NMR STRUCUTRE OF 5'-R(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : AN RNA HAIRPIN CONTAINING THE IN VITRO SELECTED CONSENSUS SEQUENCE FOR NUCLEOLIN RBD12

Molecular Description:

sNRE26

Structural Keywords:

SINGLE STRAND, LOOP, HAIRPIN LOOP

Nucleic Acid Sequence:

Click to show/hide 1 nucleic acid sequences

Protein Sequence:

No Protein Sequence Found

Primary Citation:

Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.
Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin 
Nucleic Acids Res., 31, pp. 6461 - 6472, 2003.

Experimental Information:

SOLUTION NMR

Cell Constants:

a =   b =   c = (Ångstroms)

α =   β =   γ = (degrees)

Refinement:

The structure was refined using the program. The R value is for reflections in the resolution range to Ångstroms

Number of Models:

Number of Models: 17 Structures

Sample Details:

1-1.5mM sNRE26 NA, in 10mM potassium phosphate buffer, 100mM potassium chloride, 50uM EDTA, 0.02% NaN3, 95% H2O, 5% D2O 95% H2O, 5% D2O