A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 18-May-2016 number of released structures: 8196
Search for released structures

NDB ID: 1R7W    PDB ID: 1R7W 


Title:

NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE

Molecular Description:

RNA

Structural Keywords:

SINGLE STRAND, LOOP, BULGES

Nucleic Acid Sequence:

Click to show/hide 1 nucleic acid sequences

Protein Sequence:

No Protein Sequence Found

Primary Citation:

Du, Z., Ulyanov, N.B., Yu, J., Andino, R., James, T.L.
NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). 
Biochemistry, 43, pp. 5757 - 5771, 2004.

Experimental Information:

SOLUTION NMR

Cell Constants:

a =   b =   c = (Ångstroms)

α =   β =   γ = (degrees)

Refinement:

The structure was refined using the program. The R value is for reflections in the resolution range to Ångstroms

Number of Models:

Number of Models: 20 Structures

Sample Details:

1mM unlabeled RNA, 25mM NaCl, 25mM sodium phosphate buffer (pH 6.5), 90% H2O, 10% D2O 90% H2O, 10% D2O