A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 18-Sep-2019 number of released structures: 10387
Search for released structures

NDB ID: 2M90    PDB ID: 2M90 


Title:

STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] QUADRUPLEX-DUPLEX HYBRID

Molecular Description:

32-MER

Deposited:

2013-05-30

Released:

2013-07-10

Structural Keywords:

DOUBLE HELIX, QUADRUPLE HELIX, HAIRPIN LOOP, TETRAPLEX

Nucleic Acid Sequence:

Click to show/hide 1 nucleic acid sequences

Protein Sequence:

No Protein Sequence Found

Primary Citation:

Lim, K.W., Phan, A.T.
Structural Basis of DNA Quadruplex-Duplex Junction Formation 
Angew.Chem.Int.Ed.Engl., , pp. - , 2013.

Experimental Information:

SOLUTION NMR

Number of Models:

Number of Models: 10 Structures

Sample Details:

0.5-2.0 mM DNA-1, 90% H2O/10% D2O 90% H2O/10% D2O