A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 5-Aug-2020 number of released structures: 10886
Search for released structures

NDB ID: 5DS9    PDB ID: 5DS9 


Title:

CRYSTAL STRUCTURE OF FIS BOUND TO 27BP DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

Molecular Description:

DNA-binding protein Fis/DNA Complex

Deposited:

2015-09-17

Released:

2016-07-27

Nucleic Acid Sequence:

Click to show/hide 2 nucleic acid sequences

Protein Sequence:

Click to show/hide 1 protein sequences

Primary Citation:

Hancock, S.P., Stella, S., Cascio, D., Johnson, R.C.
DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. 
Plos One, 11, pp. e0150189 - e0150189, 2016.

Experimental Information:

X-RAY DIFFRACTION

Space Group:

P 21 21 21

Cell Constants:

a = 43.29   b = 93.95   c = 154.51 (Ångstroms)

α = 90.0   β = 90.0   γ = 90.0 (degrees)

Refinement:

The structure was refined using the PHENIX program. The R value is 0.2243 for 19020 reflections in the resolution range 45.162 to 2.561 Ångstroms with Fobs >  1.34 sigma(Fobs) and with I >  0.0 sigma(I)