A Portal for Three-dimensional Structural Information about Nucleic Acids
As of 19-Oct-2017 number of released structures: 9178
Search for released structures

NDB ID: 5J05    PDB ID: 5J05 


Title:

DIY G-QUADRUPLEXES: SOLUTION STRUCTURE OF D(GGGTTTGGGTTTTGGGAGGG) IN SODIUM

Molecular Description:

DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3')

Nucleic Acid Sequence:

Click to show/hide 1 nucleic acid sequences

Protein Sequence:

No Protein Sequence Found

Primary Citation:

Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.
DIY G-Quadruplexes 
To Be Published, , pp. - , 0.

Experimental Information:

SOLUTION NMR

Cell Constants:

a =   b =   c = (Ångstroms)

α =   β =   γ = (degrees)

Number of Models:

Number of Models: 10 Structures

Sample Details:

1 mM DNA, 93% H2O/7% D2O 93% H2O/7% D2O